New  miRDeep -predicted miRNA candidates from M. truncatula. The names, sequences, sequence positions, lengths, the miRDeep stringency class, locus annotation are given.
candidate identifier mt3 coordinates conservation (mature ≥8%) a prediction type b locus annotation c mature sequence mature length star sequence star length myc precursor  nm precursor  myc mature  nm mature  myc star  nm star 
new_miRc_2a MtChr1_27588062_27588224_0 G.m. new.4. TE+ CATGAAAGAATGATGGATAATTT 23 ATTATCCACCATTCTTCAAAGG 22 19,42 15,09 3,18 2,63 0 0
new_miRc_2b MtChr4_24908743_24908905_0 G.m. new.4. E+/I+ CATGAAAGAATGATGGATAATTT 23 ATTATCCACCATTCTTCAAAGG 22 19,42 15,09 3,18 2,63 0 0
new_miRc_2c MtChr3_19249738_19249900_1 G.m. new.4. E+/I+/TE+/TE- CATGAAAGAATGATGGATAATTT 23 ATTACCCACAATTTTTCAAAGG 22 21,13 19,88 3,18 2,63 0 0
new_miRc_2d MtChr6_2598040_2598202_1 G.m. new.4. TE+ CATGAAAGAATGATGGATAATTT 23 ATTATCCACCATTCTTCAAAAG 22 23,57 19,4 3,18 2,63 0 0
new_miRc_4 MtChr6_13359770_13359933_0 new.1. TE- TGTTTTTGGAAATAGTCCCTGCA 23 CAGGGACTATTTCCAAAAACAAA 23 7,08 4,91 0,12 0 0,12 0
new_miRc_6 GE343812.1_307_469_0 new.4. CATTTAAAGAGGTACGTGAGCTG 23 GATAAAAGGTACTCTGGGGATAACAGGC 28 72,42 70,06 2,44 1,32 0 0
new_miRc_7 MtChr1_10355663_10355951_0 G.m. new.4. E+/I+/TE+ AGTGATGGAACATGGCTACGGCT 23 CCTAGCCTCTGAACCATCACTTT 23 29,31 50,3 0,98 3,23 0 0
new_miRc_8 MtChr1_21905776_21905987_1 new.4. TE+  TGCGGAGATTAAGAAAGTTGGTT 23 CTAACTCATTGATTGCCAATGCAAG 25 3,66 3,47 0,98 0,24 0 0
new_miRc_9a MtChr2_12845051_12845181_1 new.4. IG CATTAATGTGGGTTTGGACGGTT 23 TTTTTCGGATTAATGCGATAATGGT 25 8,55 8,38 2,08 2,04 0 0
new_miRc_9c MtChr3_24856107_24856183_0 new.2. E+ CATTAATGTGGGTTTGGACGGTT 23 CCGGAAAACCTCAGCATTGGAT 22 7,08 7,31 2,08 2,04 0 0
new_miRc_11 MtChr3_2238762_2238873_0 new.2. IG TATGAACGGTCAATGAGGATGGA 23 CACCCTCTCCTCCTTCTACA 20 16,98 18,32 0,49 0,72 0 0
new_miRc_12 MtChr3_268789_268866_1 P.t. new.2. IG CATTTTGAACGGTCGGATTGAAC 23 TTAGGTCCCTGTAGTGAA 18 17,1 27,19 2,2 4,67 0 0
new_miRc_13a MtChr3_29573002_29573090_0 new.2. TE+ AGTGGCAGATTGGAAGGATTAGT 23 TAATCAGATGTAATTAGGACCATTTT 26 7,57 8,02 1,22 0,48 0 0
new_miRc_13b MtChr5_14626113_14626260_1 new.2. I+/TE- AGGGGCAGATTGGAAGGATTAGT 23 TAATCCTTCCAATCTGCCCTTGC 23 15,51 18,2 2,2 2,63 0 0
new_miRc_14 MtChr3_38010196_38010305_0 new.2. TE+ TGATGACTGATAGTTGATAGCTT 23 GCTACTTGAAGTGTTTGGTAAAATTAGC 28 13,68 10,54 5,13 3,11 0 0
new_miRc_15 MtChr4_27679594_27679689_1 L.j.,G.m. new.2. TE- ACAACAGGAGGAAGAACAAGGTT 23 TTTTGTTTCTTTTTAAAGACTGGATAAA 28 18,69 19,76 3,42 3,71 0 0
new_miRc_16 MtChr5_22079920_22079987_1 L.j.,A.t.,G.m.,P.t. new.2. I-/TE+ CTGATGAGTAGGAGGGCGCGGCG 23 CGCGCGACCTATACCCGGCCGTTGGGG 27 317,9 462,63 20,76 32,34 0 0,24
new_miRc_17 MtChr7_31029110_31029351_1 new.2. I+ TTCCCTGTAAGATTTCGTTTGAT 23 CAAACTATCTTACCGGGAATG 21 4,52 3,83 2,56 1,92 0 0
new_miRc_18a MtChr4_12392421_12392626_1 new.3. TE- CGAGGAGGCGGTATTGTTTGAA 22 CACAATGCCGACTTCTTGAGTA 22 51,91 45,87 11,11 8,86 0,12 0
new_miRc_19a AW560465.1_1_496_0 new.3. GAATAGCAACAAAGATGAACAA 22 GTTTGTCTTGAGTGTTATTGCA 22 7,33 7,9 1,47 1,68 0 0
new_miRc_19b BE941747.1_1_466_0 new.3. GAATAGCAACAAAGATGAACAA 22 GTTTGTCTTGAGTGTTATTGCA 22 7,33 7,9 1,47 1,68 0 0
new_miRc_25c MtChr5_19410211_19410441_1 new.1. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTGTT 22 58,99 44,67 18,93 14,49 0 0
new_miRc_25d MtChr6_18802118_18802348_0 new.1. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCATGTTGTT 22 56,67 41,2 18,93 14,49 0 0
new_miRc_26e MtChr8_17750395_17750484_1 new.1. E- AGGAGGATGAGCTACCTGCTT 21 TCAGGTGGTTGTTGATCCATC 21 643,38 476,53 409,26 301,08 0 0,24
new_miRc_27c MtChr8_36566567_36566797_0 new.1. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTGTT 22 58,38 43,47 18,93 14,49 0 0
new_miRc_29 MtChr5_16538528_16539096_1 A.t.,P.t. new.1. I+ CAGGAATACTGTATTGTCTAAT 22 TAGACAATACAGTATTCCTATC 22 73,4 65,75 11,36 8,74 0 0
new_miRc_32 MtChr4_12386420_12386691_1 L.j. new.4. IG CAGAGGCTTTTTGGTAGAGGAA 22 ACAGCTCAGAGAAGAACTT 19 28,33 29,22 3,66 6,11 0 0
new_miRc_33 MtChr4_8771430_8771570_0 new.4. I+ TTTGGAGAGAATATTGAAGACA 22 GCTTTGAATCTCTCCAATAT 20 6,6 4,31 0 0 0 0
new_miRc_34 MtChr7_2407101_2407285_1 new.4. IG AGGTGATCGGAAATTTGTGCTA 22 GCTACATTTTTTCGATCGCATTC 23 15,75 13,17 1,22 0,6 0 0
new_miRc_36a AC135504_29040_29105_1 new.2. I-/TE- TGAGACTTGGTAGTAAGATGAT 22 AGTCTTGAGATAGAGGTCTTTAGCG 25 26,62 18,56 14,04 8,74 0 0
new_miRc_36b MtChr7_49859_49924_1 new.2. TE- TGAGACTTGGTAGTAAGATGAT 22 AGTCTTGAGATAGAGGTCTTTAGCA 25 26,87 18,8 14,04 8,74 0 0
new_miRc_36c MtChr2_14112414_14112479_0 new.2. TE- TGAGACTTGGTAGTAAGATGAT 22 AGTCTTGAGATAAAGGTCTTTAGCA 25 26,01 17,84 14,04 8,74 0 0
new_miRc_37 AC140773_1015_1081_0 G.m. new.2. TE- CTGTTGTTGTTGAGCTGGTGGC 22 TGCATTGCTGAACGATGGCATTA 23 4,4 5,63 1,22 1,32 0 0
new_miRc_38 MtChr4_12386604_12386716_1 new.2. TE- TGGCGAAGTGAGGATGGACTAT 22 CGGTCATTTTGGCTTTAGCAAAGTC 25 28,94 29,7 5,13 4,43 0 0
new_miRc_39a AC202596_49555_49630_1 new.2. TE- CTTTCAAACTGTGGCAGAAGAA 22 CTTTTGTGACTGATGAATGAT 21 40,43 38,68 7,82 7,66 0 0
new_miRc_39b MtChr7_51220_51326_1 new.2. TE- CTTTCAAACTGTGGCAGAAGAA 22 CTTCTGTATGATCTAGTC 18 39,2 36,65 7,82 7,66 0 0
new_miRc_40a AC202596_49804_49886_1 new.2. TE- CATCAGTAGATGCAGTTGGGAT 22 GATAGCTGCGGCTGATTGTT 20 7,33 6,83 1,71 0,96 0 0
new_miRc_40b MtChr7_9659230_9659327_1 new.2. TE- CATCAGTAGATGCAGTTGGGAT 22 GATAGCTGTGGCTGATTGTT 20 7,45 6,95 1,71 0,96 0 0
new_miRc_41 MtChr1_31588395_31588491_1 G.m. new.2. I+ TGCATGTGATGAGTTACTCGGA 22 CGAGATTCTGATGCACATCAAT 22 9,28 6,71 0,98 0,6 0 0
new_miRc_43a MtChr1_9905373_9905436_0 A.t. new.2. E+ CTGCATTGACGTACTACTGGCG 22 CCAGAAACAGCTCGTTACACGGCT 24 2,08 11,38 0,73 3,83 0 0
new_miRc_43b MtChr1_9856376_9856439_1 A.t. new.2. E+ CTGCATTGACGTACTACTGGCG 22 CCAGAAACAGCTCGTTACACGGCT 24 2,08 11,38 0,73 3,83 0 0
new_miRc_44 MtChr4_15676890_15676961_1 new.2. TE- GCTGCTGTAGTTCCTTCGGCGA 22 GCCAAGGATGCCAGAGGCAC 20 9,16 10,78 4,03 4,79 0 0
new_miRc_47 MtChr6_16338556_16339179_1 new.2. I- CAAGATCAATGGCATAGTTCCT 22 GAACTATGCTATTGATCTTGAT 22 62,65 49,7 3,42 2,28 0 0
new_miRc_52 MtChr7_639700_639798_0 new.2. E+ TGTGGTTGTGTCTTTTTGGCGT 22 GTTGGGAAAGGACCCAACAGTGCT 24 5,5 5,99 1,83 1,8 0 0
new_miRc_53a MtChr7_641245_641313_0, new.2. IG CTTTGAGTCGAGCGAGGAGCAT 22 TACTCTTGCTTGAAGGAGAG 20 10,5 12,22 0,98 2,16 0 0
new_miRc_53b MtChr7_639936_640004_1 new.2. IG CTTTGAGTCGAGCGAGGAGCAT 22 TACTCTTGCTTGAAGGAGAG 20 10,5 12,22 0,98 2,16 0 0
new_miRc_55 MtChr8_26263143_26263335_1 new.2. I+/TE- TGGTTGTTGGATTGATAGTGGC 22 CTCGGTGTAATCATAACCATA 21 26,75 30,54 2,44 3,95 0 0
new_miRc_57h MtChr4_39899480_39899579_0 Z.m. new.1. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAGCCTAA 22 107,35 93,65 94,9 82,87 0,24 0
new_miRc_57i MtChr4_31807750_31807849_1 Z.m. new.1. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAGCCTAA 22 107,35 93,65 94,9 82,87 0,24 0
new_miRc_57k MtChr1_30170484_30170583_0 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATTTAAAGCACGTCTAA 22 108,57 93,89 94,9 82,87 0 0
new_miRc_58a AW691211.2_327_411_0 G.m. new.1. TGGACATCCTACATATGGCAA 21 GCCTTATGGGAGGAAATTGTTGAAA 25 153,15 134,25 96,73 85,39 0 0
new_miRc_58b BF642548.1_9_91_0 G.m. new.1. TGGACATCCTACATATGGCAA 21 GCCTTATGGGAGGAAATTGTG 21 153,52 134,61 96,73 85,39 0 0,12
new_miRc_66 MtChr5_16538747_16538875_1 new.1. I+ TGCGTATACTGTGGCGGTAAG 21 TACCGCCACAGTATACACAGC 21 3,66 6,35 2,2 2,04 0 0
new_miRc_67 MtChr6_1527443_1527682_1 Z.m.,L.j.,A.t.,G.m.,P.t. new.1. TE+/TE- TGTGAAAAGTGCTGGTCTCGG 21 GAGACCAGCACTTTTCACATG 21 10,63 10,18 2,08 1,92 0 0
new_miRc_71a MtChr1_1672442_1673012_0 G.m. new.4. UTR+/E+ GAGGAGGATGGCCGTCTGGAC 21 ATTGACGTCCAAAAACCTCCTTGT 24 63,39 50,66 5,74 4,07 0 0
new_miRc_72 MtChr1_18633362_18633612_1  new.4. I- GTGATAGTTCGTCCGGATGAC 21 CCCCGCAGCGAACTTGTTCCT 21 200,42 304,79 21,86 25,27 0 0
new_miRc_73b MtChr3_11371819_11371937_1 L.j.,A.t.,G.m.,P.t. new.2. E+/TE+ TTGTTGTGGATGGCAGAAGGC 21 TGAACTGTTATCCAGATCATTA 22 21,49 18,92 4,64 3,95 0 0
new_miRc_74 MtChr3_7054900_7055200_0 L.j. new.4. E+ TGGGAGAAGAATGTGTGGCTT 21 GCCTTGTTTTTCTTTTTGT 19 27,36 28,14 8,06 7,54 0 0
new_miRc_75 MtChr4_24726034_24726571_1 Z.m.,L.j.,G.m.,P.t. new.4. E+/TE+ TGTAGGAATTTGTGGGATGGG 21 TATCTTATGCCAATGGCCTACCAC 24 49,58 42,4 3,3 2,51 0 0
new_miRc_77 MtChr4_7687517_7687651_0 new.4. I+/UTR+ TGTGATTGCTACGTTTATGAT 21 CAATTGAATGTAATGCAACCACGTG 25 10,75 10,66 3,91 5,03 0 0
new_miRc_79 MtChr5_36851137_36851405_1 new.4. E-/I-/TE+ TAAAGTATTGGGACATGGCTA 21 GCCTTTGAACCATAACTTTTTT 22 48,49 60,36 6,47 4,79 0 0
new_miRc_80a MtChr5_38245920_38246194_0 Z.m.,L.j.,G.m.,P.t. new.4. TE+ CAAGGTGATGGAACATGGCTG 21 GTCCATTGAACCATCATTTTTTT 23 197,24 302,99 17,34 12,46 0 0
new_miRc_80b MtChr5_38303239_38303530_0 Z.m.,G.m. new.4. UTR-/TE+ CAAAGGGATGGAACATGGCTG 21 GCCCATTGAACCATCACTTTTTT 23 163,29 245,87 7,57 4,79 0 0
new_miRc_80c MtChr5_38344616_38344900_1 Z.m.,L.j.,G.m.,P.t. new.4. UTR-/TE+ CAAGGTGATGGAACATGGCTG 21 GCCCATTGAACCATCATTTTTTT 23 140,21 200,96 17,34 12,46 0 0
new_miRc_80d MtChr5_38361603_38361886_1 Z.m.,L.j.,G.m.,P.t. new.4. UTR+/TE+ CAAGGTGATGGAACATGGCTG 21 GCACACTGAACCATCACTTTTTT 23 133,37 206,11 17,34 12,46 0 0
new_miRc_82 MtChr6_21751147_21751268_0 P.t. new.4. E+/I+/TE- TCTCTGGTTGGGATCTACGTG 21 CGTGGCACCTCACTTAAGAGATG 23 13,07 18,44 2,32 3,95 0 0
new_miRc_82 MtChr6_21760209_21760285_0 P.t. new.2. E+/TE- TCTCTGGTTGGGATCTACGTG 21 AGAAGGTGTCAAAATGGAGGGA 22 13,07 18,56 2,32 3,95 0 0
new_miRc_85 MtChr6_21705192_21705272_1 G.m.,P.t. new.2. E-/I-  TTGAAGACAGAGGACGTTGAT 21 AAATGATGCATTGTTAGGAAAAAT 24 4,52 5,15 0,85 0,24 0 0
new_miRc_88a BF635072.1_589_654_0 Z.m. new.2. TGTGTGATCCAGAGGAACGTG 21 TGTGACTCTGGCTGTAACGGG 21 2,32 3,95 0,12 0,96 0 0
new_miRc_88b EV256767.1_608_673_0 Z.m. new.2. TGTGTGATCCAGAGGAACGTG 21 TGTGACTCTGGCTGTAACGGT 21 3,79 7,19 0,12 0,96 0 0
new_miRc_88c MtChr1_6986315_6986376_1 Z.m. new.2. TGTGTGATCCAGAGGAACGTG 21 TGTGACTCTGGCTGTAACGGT 21 5,01 9,94 0,12 0,96 0 0
new_miRc_90 MtChr1_10281574_10281672_0 new.2. E+/I+ GGGCTGGTCTGTTGGCTGCAA 21 GCGCCAACTTGTGACCCGAGTGG 23 20,27 35,81 1,83 2,51 0 0
new_miRc_91 MtChr1_12894045_12894155_1 Z.m.,G.m. new.2. IG AGGATGTGATGATAGTAATTG 21 CTGACTTCTTATCTGATCCTCT 22 2,44 4,31 0,37 0,72 0 0
new_miRc_92 MtChr1_17064964_17065029_1 L.j.,G.m. new.2. TE- TAGACGGTTGAGATTTGGTGT 21 ACCTGGTATCAACCGATCCTAAC 23 17,59 23,23 10,99 13,29 0 0
new_miRc_93 MtChr1_27380857_27381051_0 new.2. IG GAAAAACATGAATGTCGAGCG 21 CCCGGCATTCATGTTTTCCT 20 7,21 6,11 5,98 4,55 0 0
new_miRc_94d MtChr6_6418323_6418390_0 Z.m. new.2. E+ TGACTGAATGGAAGAGTGCAT 21 TCATTTTTGTTTGGTCGTA 19 40,3 40,24 12,34 13,05 0 0
new_miRc_97a MtChr2_14788889_14788966_0 new.2. E+/I+/TE+ TGCAAAATCCGGAAGTGGCAA 21 TCCACTTCCTAATGGTAAT 19 50,56 47,9 4,27 4,31 0 0
new_miRc_97b MtChr2_14689012_14689089_0 new.2. E+/I+/TE+ TGCAAAATCCGGAAGTGGCAA 21 TCCACTTCCTAATGGTAAT 19 50,56 47,9 4,27 4,31 0 0
new_miRc_97c MtChr7_8808903_8808980_1 new.2. E+/I+/TE+ TGCAAAATCCGGAAGTGGCAA 21 TCCACTTCCTAATGGTAAT 19 50,56 47,9 4,27 4,31 0 0
new_miRc_97d MtChr6_9637075_9637152_0 new.2. I+/TE+ TGCAAAATCCGGAAGTGGCAA 21 TCCACTTCCTAATGGTAAT 19 50,81 48,14 4,27 4,31 0 0
new_miRc_97e MtChr3_11724277_11724354_1 new.2. I+/TE+ TGCAAAATCCGGAAGTGGCAA 21 TCCACTTCCTAATGGTAAT 19 50,81 48,14 4,27 4,31 0 0
new_miRc_98 MtChr2_21071388_21071453_0 L.j.,G.m. new.2. E+ ACCGGATCGATGGGAAGCAAG 21 TGTTCTCCATAGACTGGTAC 20 1,59 4,55 0,61 1,2 0 0
new_miRc_99 MtChr2_21537889_21537979_1 L.j. new.2. E+ TTTGTTGGGTGGAATGGTGTT 21 CATCAATCCAAACATATAAGG 21 1860,9 1831,97 1379,34 1317,6 0 0
new_miRc_100 MtChr2_21538108_21538190_0 new.2. E-/I- TCGTCATGAAAGTCAAGGGCC 21 CCTTTGAAAGTGCGGCC 17 1089,89 969,34 995,36 875,93 0 0
new_miRc_102 MtChr3_20682009_20682099_1 new.2. I- ATAGGCGAATTGGAAGGGACA 21 TCCCTTCCAATTCGGTTATTA 21 3,54 2,51 1,83 1,08 0 0
new_miRc_103 MtChr3_6908377_6908460_1 new.2. E+/TE+ TCTTTATCGGCAAGGACAGAG 21 TTTTGCTGGTATAGGAA 17 20,76 16,05 9,16 8,02 0 0
new_miRc_104 MtChr4_1888021_1888104_0 new.2. E-  TTCGACTCTAACTGGATGGTC 21 GTGTCCAGTAGTTGAATC 18 487,54 357,96 224,48 141,44 0 0
new_miRc_105 MtChr4_1889682_1889747_1 A.t. new.2. E+/I+/TE- TGAAACGCCGGATTCACCTTC 21 AGGACGATCACTCGCTTCAAA 21 131,17 153,53 72,06 70,06 0 0
new_miRc_107 MtChr4_2084943_2085006_1 G.m. new.2. E-/TE- TGTACATCGTAGAACACAGGC 21 TTGTGGTTCTAAAACACT 18 10,63 13,05 2,32 0,96 0 0
new_miRc_108 MtChr4_24726229_24726325_1 Z.m.,L.j.,G.m. new.2. E+/TE+ AATCGTGAATGTTTAGGTGTA 21 CACTTATCATTCTCGATAAT 20 4,15 3,11 1,1 0,72 0 0
new_miRc_109 MtChr4_25328465_25328531_1 G.m. new.2. E-/TE+ AACTTGACTGTAGTGAAGGAT 21 TCTCGCAAGCACCAAGTTGA 20 6,47 7,19 1,34 1,32 0 0
new_miRc_110 MtChr4_25471070_25471139_1 P.t. new.2. E+/I+ TAACCTCGTTGCTCTCGGTAC 21 GCCGATGTGGTGACGATATGGCC 23 16,12 11,5 3,05 2,28 0 0
new_miRc_111 MtChr4_27499563_27499659_1 new.2. E+/TE+ TTGGCACAGTCAGAATAGGTT 21 AAAGTTCTCATTGTGCTTGAC 21 31,75 27,78 22,96 19,64 0 0
new_miRc_117 MtChr5_29647792_29647911_1 L.j.,A.t. new.2. TE+ TAGAGAAGAGCGTGCAGAGCT 21 ACATGCCACGCTCATCCTTTATA 23 4,64 5,63 0,73 1,32 0 0
new_miRc_120 MtChr5_29963495_29963616_0 L.j.,G.m.,P.t. new.2. TE+ TGGAGAAAAAGAATGGCTTGA 21 GAGCTACTTTCATTTAAACCCAAC 24 8,06 9,94 1,59 1,92 0 0
new_miRc_122 MtChr5_9243480_9243552_0 Z.m.,L.j.,G.m.,P.t. new.2. IG TGGAGACCTGAACTGAAGAGG 21 TTTTTTTCCCTTTTCCTTA 19 10,26 6,71 2,44 0,96 0 0
new_miRc_123 MtChr6_11648122_11648206_0 G.m. new.2. IG TGTGGCAATAGGCAAGGAGTT 21 GTTCGCCTCTTGCCGCAAA 19 12,21 14,61 4,03 3,95 0 0
new_miRc_127a MtChr6_21697220_21697280_0 L.j.,G.m. new.2. E+ CTTTGTTGGAAGAGCTAGGCA 21 CAAAATAGTTCAAGCAAAGAG 21 5,25 5,39 0,73 1,08 0 0
new_miRc_127b MtChr6_21910787_21910847_0 L.j.,G.m. new.2. E+ CTTTGTTGGAAGAGCTAGGCA 21 CAAAATAGTTCAAGCAAAGAA 21 5,25 5,39 0,73 1,08 0 0
new_miRc_129a MtChr7_1271877_1271965_0 Z.m.,A.t.,P.t. new.2. TE- TGCGGTGCCTGAGAAGATGAG 21 CAAAGTCGAAGGCAGCCGTGGA 22 6,84 6,83 1,22 0,72 0 0
new_miRc_129b MtChr7_1273796_1273883_1 Z.m.,A.t.,P.t. new.2. TE- TGCGGTGCCTGAGAAGATGAG 21 CAAAGTCGAAGGCAGCCGTGGA 22 6,84 6,83 1,22 0,72 0 0
new_miRc_129c MtChr5_24736567_24736655_1 Z.m.,A.t.,P.t. new.2. TE- TGCGGTGCCTGAGAAGATGAG 21 CAAAGTCGAAGGCAGCCGTGGA 22 6,84 6,83 1,22 0,72 0 0
new_miRc_136 MtChr8_1861425_1861533_1 Z.m.,L.j.,G.m. new.2. E+ TTTGTTTAGTAGGGATTTGGG 21 AAAGTCATCTACAATAATCT 20 29,92 25,87 5,86 5,63 0 0
new_miRc_140 MtChr8_4760733_4760808_0 G.m.,P.t. new.2. E+/I+ GAAGAGGGTAGGGATATGATA 21 TCATAACCCACTCTCCTTG 19 16,61 6,47 2,69 0,72 0 0
new_miRc_145a MtChr5_10397707_10397814_0 Z.m. plant.1. IG TCGCTTGGTGCAGGTCGGGAA 21 CCCGCCTTGCATCAACTGAAT 21 5033,72 4267,29 4876,54 4124,9 67,66 52,45
new_miRc_150 MtChr3_27732644_27732721_0 new.2. E-/I- AGCACTGTGAGATTGGGCCG 20 GCCCAATCTCAGAGTCCCAA 20 8,55 9,1 0,85 2,04 0 0
new_miRc_152 MtChr5_22178088_22178184_0 G.m. new.1. UTR+ ACCGACGCGGATTGTGATGGTGGCC 25 TCATCATCACGATTGTGGTGTCGGCCT 27 2760,14 5343,81 165,61 842,99 0 0
new_miRc_153 MtChr5_22080731_22080814_1 new.3. I-/TE+ ACGTCATCATCACGATTGTGGGCTA 25 ACCGACGTGGATTTTGATGGTGGCCCAA 28 460,43 667,9 7,69 26,95 0 0
new_miRc_154f MtChr1_10940707_10940772_0 new.1. IG AGGCATTTGCTAGAATACACCCAC 24 AGGAGTATTTTGGCAAGTGAATAA 24 11,48 13,53 8,55 10,78 0 0
new_miRc_155c MtChr2_27877821_27877928_0 new.1. TE- CCAGAGTGGAATGAAGATATGGTT 24 CCATGTTGATTAAGAAATTTCGGTT 25 14,29 16,29 1,95 2,4 0 0
new_miRc_155d MtChr7_22175653_22175760_1 new.1. TE- CCAGAGTGGAATGAAGATATGGTT 24 CCATGTTGATTAAGAAATTTCGGTT 25 11,48 13,05 1,95 2,4 0 0
new_miRc_155e MtChr3_23802706_23802813_0 new.1. TE- CCAGAGTGGAATGAAGATATGGTT 24 CCATGTTGATTAAGAAATTTCGGTT 25 11,48 13,05 1,95 2,4 0 0
new_miRc_157 MtChr1_16450143_16450214_0 new.1. TE+ CAATGGAAAGAGAATAAGAGGACA 24 TTTTTTTTCTCTCTTTTCATTGGT 24 3,66 2,99 1,1 1,44 0 0
new_miRc_158a MtChr1_22037529_22037630_0 new.1. TE+ TTTAGACAACTTGTACGTGGGACA 24 TTTTATACGATTTTTGAGGG 20 50,81 59,76 15,14 13,53 0 0
new_miRc_158b MtChr7_16042988_16043096_0 new.1. TE+ TTTAGACAACTTGTACGTGGGACA 24 TTTTATACGATTTTTGAGGGACAAAAT 27 50,56 58,8 15,14 13,53 0 0
new_miRc_160a MtChr2_12987254_12987328_0 new.1. TE- TGGAAACTTCTACGGTACACTCAC 24 AGGTGTACCGGTACTCCTGCTTCTTAATT 29 3,54 3,95 0,73 1,32 0 0
new_miRc_160b MtChr2_7915344_7915418_0 new.1. TE- TGGGAACTTCTACGGTACACTCAC 24 AGGTGTACCGGTACTTCTGCTTCTTAAT 28 36,15 37,13 26,87 26,35 0 0
new_miRc_160c MtChr2_8151292_8151357_0 new.1. TE- TGGGAACTTCTACGGTACACTCAC 24 GAGGTGTACCGGTACTTCTGCTT 23 35,42 36,89 26,87 26,35 0 0
new_miRc_160d MtChr3_1188398_1188459_0 new.1. TE- AGGGAACTTCTACGGTACACTCAC 24 GAGGTGTACCGGTACTCCTGCT 22 89,28 93,65 76,7 79,16 0 0,12
new_miRc_160e MtChr3_8117288_8117363_0 new.1. TE- AGGGAACTTCTACGGTACACTCAT 24 AGGTGTACCGGTACTCCTGCTTCCTAA 27 21,98 22,28 10,01 12,34 0 0
new_miRc_160f MtChr5_2723236_2723308_1 new.1. TE- AGGGAACTTCTACGGTACACTCAC 24 GAGGTGTATCGGTACTCATGCTTCTTA 27 94,04 96,89 76,7 79,16 0 0
new_miRc_160g MtChr7_16197203_16197272_0 new.1. TE- AGGGAACTTCTACGGTACACTCAC 24 GAGGTGTACCGGTACTCTTGCTTCA 25 91,96 95,69 76,7 79,16 0 0
new_miRc_160h MtChr7_16124300_16124369_1 new.1. TE- AGGGAACTTCTACGGTACACTCAC 24 GAGGTGTACCGGTACTCTTGCTTCA 25 91,96 95,69 76,7 79,16 0 0
new_miRc_160i MtChr7_33092168_33092234_0 new.1. TE+/- AGGGAACTTCTACGGTACATTCAC 24 GAGGTGTACCGGTACTCCTGCTTCTTAA 28 8,92 8,86 5,25 3,35 0 0
new_miRc_160j MtChr3_26678953_26679023_1 new.3. TE- AGGGAACTTCTACGGTACACTCAC 24 GAGGTGTACCGGTACTCTTTCTTCAT 26 91,23 93,89 76,7 79,16 0 0
new_miRc_160k MtChr5_6122310_6122380_1 new.3. TE- AGGGAACTTCTACGGTACACTCAT 24 GAGGTGTACCGGTACTCTTCCTTCA 25 20,52 22,16 10,01 12,34 0 0
new_miRc_161 MtChr2_13044973_13045075_1 G.m. new.1. I-/TE- AGGTGTTGGAGGCTGCAATGAAGG 24 ATTAAGGCGGAATTTCCAACAAAACCCTC 29 15,51 15,21 3,79 4,07 0 0
new_miRc_162 MtChr2_15125883_15125993_1 P.t. new.1. I- AAAAGAATACTCATACATAACATT 24 TGTTATGTATGTGTATTCTTTTGG 24 61,8 80,24 56,18 71,74 0,24 0,12
new_miRc_163 MtChr2_22306363_22306471_0 new.1. IG TATATAATCCGAACTGTATCAGCA 24 CGTTACATGATTTTTCGGATTACATAAT 28 12,82 9,7 3,66 3,47 0 0
new_miRc_164a MtChr2_23803064_23803139_1 new.1. TE- CAGGTACAGGACAAACTGGAGGCA 24 ACTCTAGTTGTCCAGTGTTTGAT 23 27,11 22,75 11,6 8,5 0 0
new_miRc_164b MtChr3_22546391_22546476_0 new.3. I-/TE+ CAGGTACAGGACAAACTGGAGGCA 24 ACTCCAGTTGTCCAGTGTTTGAT 23 25,65 22,04 11,6 8,5 0 0
new_miRc_164c MtChr3_31230352_31230437_1 new.3. TE- CAGGTACAGGACAAACTGGAGGCA 24 ACTTCAGTTGTCCAGTGTTTGAT 23 25,65 21,92 11,6 8,5 0 0
new_miRc_164d MtChr8_25549429_25549514_1 new.3. TE- CAGGTACAGGACAAACTGGAGGCA 24 TTATCCAGTTTTTGATTTGTAAAACTGTT 29 48 55,93 11,6 8,5 0 0
new_miRc_166 MtChr2_4781886_4781973_1 new.1. TE+ GATGGGTGAAACTGAATTTCGGCA 24 CAATCGGTTTCTTCAGAATTCGG 23 4,03 5,03 2,32 2,4 0 0
new_miRc_168a MtChr3_19751021_19751085_0 new.1. TE+ TAGGGGCTGTAGTTTGAGAAGAGG 24 TCTATCTCAAGGGTTAGGGGCTGTAGT 27 9,4 16,29 2,32 4,31 0 0
new_miRc_169 MtChr3_33908508_33908583_1 new.1. TE+ ATGGACCGTGATGGGTTGGACCAT 24 GGTTCATGCCCTCAGCCGTTT 21 5,74 6,83 2,08 2,87 0 0
new_miRc_172 MtChr3_38838694_38838799_1 new.1. IG GTTAGGCTGGGATTAAATGATGGT 24 CTTCATTTAAACCGGCCTAACAA 23 7,69 7,66 2,2 2,63 0 0
new_miRc_174 MtChr4_19990217_19990437_1 new.1. TE+/- TTAGGGGACCAAATTGAGACAGTT 24 TTGTCTCAATTTGGTCCCCTAAGT 24 8,79 8,26 0,98 1,68 0 0
new_miRc_176 MtChr4_36078761_36078832_0 new.1. TE+ CAAACTGCATAGGACACGCGAGAA 24 TTATAGGGTGTTTATGTTGTTGGA 24 7,82 7,07 4,15 3,47 0 0
new_miRc_177 MtChr4_36166783_36166866_0 new.1. TE+ TGACGTTTTGGGCATTTCACACAT 24 GTGTGAGAAAGAGATATTATG 21 8,18 8,86 3,05 4,07 0 0
new_miRc_178 MtChr4_38704479_38704641_1 L.j.,G.m. new.1. I-/TE+ TTCTTATATATAGGACCGGAGGGA 24 CTCCGGTCCGGTCCTATTTATAAGAAAA 28 4,76 4,91 0 0,48 0 0
new_miRc_179 MtChr4_41013377_41013514_0 new.1. UTR- AGGACTCCGACATCCGATGAGCAT 24 GCACATCGCATGCTGGATTCCTGT 24 2,81 4,91 0 1,68 0 0
new_miRc_180 MtChr4_41135926_41135998_1 new.1. I-/TE- AGTTAACTGCCGAGGAAAACTGAA 24 TAGGAATCCGGCGGCAGTTAGGTGC 25 2,69 4,07 1,71 1,92 0 0
new_miRc_181 MtChr5_13010642_13010702_0 new.1. IG CTGTGATTAAATCTGGACCGACGG 24 GATGGCTGAGATTATATTACTGTG 24 8,92 5,87 4,27 2,51 0 0
new_miRc_182 MtChr5_13453092_13453154_1 new.1. I- ACCTGTAGAAAGAAAAGAAACGCA 24 CACAAATCTTATCCTTCTGCGTGC 24 5,98 3,59 2,44 1,8 0 0
new_miRc_184 MtChr5_15440470_15440614_1 new.1. IG AAGGATTTCCTTATGCACCATAAC 24 TATGGTGCATAAGGAAATCCGTAT 24 6,6 5,27 4,27 3,35 0 0
new_miRc_185 MtChr5_18556992_18557152_1 new.1. IG AGAATCCACTTTATTCAACACACT 24 TGTGCTGAATATAATAGATTCCTT 24 12,7 13,41 0 0,12 0 0
new_miRc_186 MtChr5_19991319_19991397_1 new.1. TE- AAGTAGATCATGCAAACTTAGTTT 24 ACTAAGTTTAAGTAGGTCATGTAA 24 4,4 4,55 0,98 1,2 0,24 0,24
new_miRc_189 MtChr5_27736866_27736979_0 new.1. UTR-/TE- GCTCAGTTGGTAGGGATATTGCAT 24 GTGAGCTCTAGCCACTAGGCTA 22 185,52 166,95 112,36 94,97 0 0
new_miRc_191 MtChr5_37608269_37608402_1 new.1. TE- AAGTCAAAGTTGATCTGTCCGTTA 24 ACGGATATATCAGCTTTGGTTTAA 24 6,47 7,07 2,08 2,16 0 0
new_miRc_192 MtChr5_6803384_6803474_0 new.1. IG TAAAATTAGGGCTTACATGTTAAC 24 TTAGGTGTGAGCATTAGGGTTAAA 24 14,78 21,32 3,05 3,11 0 0,12
new_miRc_194 MtChr6_3366656_3366730_0 new.1. TE- ACTGACTCAAACAGACTTGACACT 24 TGCAAGTTTGAAATGAATTTAAAC 24 11,24 12,34 3,91 3,83 0 0
new_miRc_195a MtChr6_6370275_6370381_1 new.1. TE- CCGGATCAACTCGGATGACTCGGT 24 CGATTAAATCGGATTGAATCGGTG 24 12,21 14,49 2,44 3,11 0 0,12
new_miRc_197 MtChr7_16311315_16311387_0 new.1. IG GACTCGATAAGAATTGGTTCGGCT 24 CTGGACATGAGTCGAGTCGAGTCGA 25 12,58 12,81 3,91 4,07 0 0
new_miRc_198 MtChr7_1968086_1968432_1 new.1. TE- AGGATTAGCGAATACAGGTACCAA 24 GGCCTCTGTAATCGCTAATTCTGG 24 96,61 96,41 16,12 11,86 0 0,12
new_miRc_199 MtChr7_21330118_21330207_1 new.1. TE- TCGTGGACATAAATGGTGGGTGGC 24 GGCCCAATAGGTCTTGGAGA 20 8,18 13,05 0,49 1,2 0 0
new_miRc_1b MtChr7_20886569_20886657_0 new.1. I- AATGCTGGAAGGTTTTGAAGGAAAC 25 TTCCCTCAAAGGCTTCCAGTATTCA 25 4,76 0,12 1,1 0 0 0
new_miRc_200 MtChr7_2407595_2407708_0 new.1. I+/E+ GTTCAGCACATATACAGAAGAACG 24 TTCTTCTGTATATCTGTTGAACAA 24 11,6 15,33 6,23 11,26 0,37 0,12
new_miRc_201a MtChr7_25773394_25773473_0 new.1. TE+ CCAGATTTGTAGCAGAAGATCCTC 24 GGTTTTCCTCGGCACTTAATTGCA 24 53,62 53,89 8,18 11,74 0 0
new_miRc_201b MtChr2_17110275_17110346_1 new.3. TE+ GCCAGATTTGTAGCAGAAGATCCT 24 GTTTTTTTCGGCAATTAACTGCAG 24 72,3 69,1 10,01 9,58 0 0
new_miRc_202 MtChr7_29679836_29679907_0 new.1. UTR-/TE+ ACTGAGCTAAGCTCACGAGGACAT 24 GCTTTGTTGAACTGTTGAAGGCTTAGGGT 29 5,01 7,07 2,93 2,99 0 0
new_miRc_204 MtChr8_20556754_20556843_1 new.1. TE- AAGTAAGAGGACCCATAAACTCAT 24 GAGTGTGGTGTCTCTCTTGCTAGT 24 16,85 11,38 11,48 7,31 0 0
new_miRc_205 MtChr8_32232917_32233296_0 new.1. IG TAGGACGAAAAATGCAACAAAAAT 24 TTTGTTGCATTTTTCGTCCTACC 23 18,56 24,31 1,34 4,19 0 0
new_miRc_206 MtChr8_3781245_3781374_0 G.m. new.1. TE- AATGCTTGCAACATCTTGGACTTA 24 AGTGTTACACTTTGTGGGGTGTTAC 25 24,3 26,47 8,92 10,9 0 0
new_miRc_207 MtChr8_5453090_5453190_1 new.1. TE- GATTGTTTGATCGTTTGTGGGTGA 24 TTCCATAGAGATTGATTGAACATCAG 26 2,44 3,95 0,37 0,6 0 0
new_miRc_209a AC147714_45376_45483_1 new.3. IG CGTGCGTATCGGGATGTATCGGAA 24 TGGATACTCTTCGGATACGTATCGGG 26 40,18 39,16 6,47 5,39 0 0
new_miRc_209b MtChr1_20566267_20566374_1 new.3. IG CGTGCGTATCGGGATGTATCGGAA 24 TGGATACTCTCCGGATACGTATCAGGA 27 39,08 38,56 6,47 5,39 0 0
new_miRc_209c MtChr1_22323212_22323324_1 new.3. IG CGTGCGTATCGGGATGTATCGGAA 24 CGGATACGTATCGAGAAGTATTGGG 25 29,8 27,31 6,47 5,39 0 0
new_miRc_209d MtChr1_32811332_32811443_0 new.3. I+ CGTGCGTATCGGGATGTATCGGAA 24 TAGATACTCTCCGGATACGTATCGGA 26 39,33 38,68 6,47 5,39 0 0
new_miRc_209e MtChr3_26212453_26212560_1 new.3. IG CGTGCGTATCGGGATGTATCGGAA 24 TGGATACTCTCCGGATACGTATCGGG 26 39,2 39,04 6,47 5,39 0 0
new_miRc_209f MtChr4_14030666_14030773_1 new.3. TE- CGTGCGTATCGGGATGTATCGGAA 24 TGGATACTCTCCGGATACGTATCGGG 26 39,2 39,04 6,47 5,39 0 0
new_miRc_209h MtChr7_23874448_23874555_1 new.3. IG CGTGCGTATCGGGATGTATCGGAA 24 CCGAATACGTATCGGAAAGTATCGGG 26 39,94 39,4 6,47 5,39 0 0
new_miRc_209i MtChr8_16734496_16734603_0 new.3. IG CGTGCGTATCGGGATGTATCGGAA 24 TGGATACTCTCTGGATACGTATCGA 25 39,08 38,32 6,47 5,39 0 0
new_miRc_210e MtChr6_52101_52185_0 new.3. TE- AAGCATTGTGGCATTGTGATTGGC 24 CAATCACAATGCCACAATGTTTGT 24 17,83 25,51 7,33 12,46 0 0
new_miRc_210f MtChr8_31988573_31988657_0 new.3. I+/TE- AAGCATTGTGGCATTGTGATTGGC 24 CAATCATAATGTCACAATGCTTGT 24 17,95 26,35 7,33 12,46 0 0
new_miRc_210g MtChr8_34664845_34664929_1 new.3. TE- AAGCATTGTGGCATTGTGATTGGC 24 CAATCACAATGTCACAATGTTTGT 24 17,83 25,63 7,33 12,46 0 0
new_miRc_211a MtChr1_10034453_10034522_0 new.3. IG AGAATGACATGGCAGAATAATCAC 24 TTAGATTTTATCAAGAAATATTCTTG 26 87,32 75,45 40,3 32,34 0 0
new_miRc_212 MtChr1_13503618_13503708_1 new.3. TE- GTTAATGAACTTCAGGTAGACACG 24 TGTCCTATACTTGATTCTTAAAAT 24 21,49 13,41 4,27 3,11 0 0
new_miRc_213a MtChr1_1451621_1451765_0 new.3. TE- AGGATTAGTAACTTCAGAGACGAA 24 TGTCTTTTGAAGCAAAACAGTGCCTTA 27 33,59 27,54 12,46 8,62 0 0
new_miRc_213b MtChr6_12859658_12859842_0 new.3. TE+/- AGGATTAGTAACTTCAGAGACGAA 24 CATCCCTGAAGTTACTAATCCTTC 24 32,49 26,59 12,46 8,62 0 0
new_miRc_214 MtChr1_1465510_1465617_0 new.3. TE+/- AACGGCAAAAGACATAAGTGACCA 24 GTCCCTTATGTTTTTGTCGTTAC 23 48,73 49,7 6,6 10,18 0 0
new_miRc_215a MtChr1_15745451_15745568_0 new.3. I-/TE- GAATTGATGATACTATGAGGACTG 24 GATGTTATAGTGTTAACTTCAT 22 21,86 25,15 2,32 5,87 0 0
new_miRc_215b MtChr1_29789016_29789146_1 new.3. TE- GAATTGATGATACTATGAGGACTG 24 GTCTTAAGTGTTACACTTTAT 21 24,91 26,23 2,32 5,87 0 0
new_miRc_216 MtChr1_19126309_19126421_1 new.3. IG AGCAAGGAAGACCTTCGGGCTCAA 24 GAGCTCGAATCTAGGTTCTCTTGGATTC 28 16,98 14,49 5,01 4,91 0 0
new_miRc_217 MtChr1_21878210_21878322_1 new.3. TE- CGTGGGAACCCCTGAAGGAGCATA 24 TCTCACCAGGGGGAGAACCATTTC 24 21,74 14,97 14,04 10,54 0 0
new_miRc_218a MtChr1_22618636_22619144_0 new.3. UTR- GACCAGTTTCGTGAGTAGGCCAAA 24 TGGCATACTCACGAAACTGATCAT 24 56,06 68,26 5,37 6,23 0 0,12
new_miRc_218b MtChr1_22528459_22528967_0 new.3. UTR- GACCAGTTTCGTGAGTAGGCCAAA 24 TGGCATACTCACGAAACTGATCAT 24 56,06 68,26 5,37 6,23 0 0,12
new_miRc_219a MtChr1_24541763_24541870_0 new.3. I+/TE+/- AAGGGACCAAAAGTGGAAGAATCT 24 ATTCCTCCACTTTTGGTCCCTCAT 24 33,71 32,93 5,86 4,07 0 0
new_miRc_219b MtChr1_25897289_25897397_0 new.3. IG GAGGGACCAAAAGTGGAGGAATCT 24 ATTCTTCCACTTTTAGTCCCTCAT 24 16,61 14,61 3,79 3,95 0 0
new_miRc_219h MtChr5_31201645_31201748_1 new.3. TE- AAGGGACCAAAAGTGGAAGAATCT 24 AATCCTCCACTTTTGGTCCCTCAT 24 28,82 27,78 5,86 4,07 0 0
new_miRc_221 MtChr1_28524013_28524141_1 new.3. IG TGGTGTTACTTGTAGTCCAGACGT 24 GTGGAGGGTGTGCGAAAAGT 20 39,2 42,04 20,64 20,36 0 0
new_miRc_222 MtChr1_3070048_3070276_1 new.3. IG GTTTGGATGTAAGACATGTGGCAA 24 ACCACATATCTTACATCCAAACCC 24 58,74 47,54 6,11 2,75 0 0
new_miRc_223a MtChr1_31296675_31296778_1 new.3. IG AATTATGTTGGGATTTATGCACGG 24 TTCCATTAATCTTAACACTAATAAAATGA 29 73,4 87,9 15,02 14,25 0 0
new_miRc_223b MtChr4_4668622_4668719_1 new.3. IG AATTATGTTGGGATTTATGCACGG 24 CATAATCGATCCCGTCTGAATTGG 24 68,76 83,83 15,02 14,25 0 0
new_miRc_224a MtChr1_4205094_4205222_0 P.t. new.3. TE- AGAAGATGAAGAAAACCTAACGTT 24 CGTTAGGTGTTCTTCATTTTCTTC 24 145,95 155,69 11,85 12,34 0 0
new_miRc_224b MtChr5_19578897_19579025_1 P.t. new.3. TE- AGAAGATGAAGAAAACCTAACGTT 24 CTTTAGGTTTTCTTCATTCTCTTT 24 116,27 124,19 11,85 12,34 0 0
new_miRc_224c MtChr8_4525846_4525970_1 P.t. new.3. TE- AGAAGATGAAGAAAACCTAACGTT 24 CATTAGGTTTTCTTCATTTTCTTC 24 148,39 147,54 11,85 12,34 0 0
new_miRc_225a MtChr1_5694945_5695055_0 new.3. TE+ GTTGTAGATCTAGACGCATGAGTA 24 CTCATCTTTAAGGTCTTCAATTT 23 18,44 13,53 2,56 3,35 0 0
new_miRc_226c MtChr5_7998882_7998951_1 new.3. TE- AGGACAAACTGGAGGCAAGAGACA 24 ACTCTAGTTGTCCAGTGTTTGTTTTGT 27 15,88 28,5 2,32 13,53 0 0
new_miRc_226d MtChr8_8623764_8623831_1 new.3. TE- CAGGACAAACTGGAGGCAAGGGAC 24 CCAGTATTTGATTTGTAAAACTGTT 25 40,43 60,36 8,92 6,23 0 0
new_miRc_228 MtChr2_19370692_19370767_0 new.3. TE+ TGTATTGGAGGAGGGTTTTGGGGG 24 TACAAAACCCTCCTCATTTGGAGG 24 4,15 2,4 1,22 0,72 0 0
new_miRc_229 MtChr2_19540145_19540275_1 A.t.,G.m.,P.t. new.3. TE- AGGAGAAGAAGATGAAGAAAACCT 24 GTTTTCTTCATTTTCTCTAGAAT 23 143,5 149,7 5,74 7,66 0 0
new_miRc_231 MtChr2_26745834_26745908_1 new.3. E-/I-/TE- GATATGAACCTGAAGTGAAGACTC 24 GCTTAACACAACTCGGGTGCTAGCAG 26 20,27 14,01 6,35 4,31 0 0
new_miRc_233b MtChr7_19987328_19987395_0 new.3. TE- AGGACAAACTGGAGGCAAGGGACA 24 TCCACTGTTTCATTTGTAAAACTGT 25 79,63 93,65 3,66 20,6 0 0
new_miRc_233c MtChr7_7782611_7782678_1 new.3. TE- AGGACAAACTGGAGGCAAGGGACA 24 TCCAGTGTTTCATTTGTAAAATTGT 25 77,55 90,66 3,66 20,6 0 0
new_miRc_234a MtChr2_4019363_4019445_0 G.m. new.3. IG TGCAATTTGGAGAGAGATAGACAC 24 GTCAAGATCCTCTCCATTTATAAC 24 18,93 16,89 3,42 3,47 0 0
new_miRc_234b MtChr4_12574983_12575065_0 G.m. new.3. IG TGCAATTTGGAGAGAGATAGACAC 24 GTAAAGATCCTCTCCATTTATAAC 24 16,98 15,57 3,42 3,47 0 0
new_miRc_234d MtChr7_22004957_22005042_1 G.m. new.3. IG TGCAATTTGGAGAGAGATAGACAC 24 GTCAAGATCCTCTCCATTTATAAC 24 18,56 16,65 3,42 3,47 0 0
new_miRc_235b MtChr3_8628023_8628113_0 L.j.,G.m. new.3. IG TTTGTAGTGGATGGATTGGATGGA 24 AATCCAATCCATTAACAAAAT 21 26,75 26,47 3,18 4,43 0 0
new_miRc_236a MtChr2_7354472_7354553_0 new.3. TE+ ATTCAGATGATAGCAACAAAGAGC 24 CCTTTTAGTTTTTGAATCG 19 132,88 120,24 15,39 11,62 0 0
new_miRc_236b MtChr3_17555915_17556000_0 new.3. IG GATTCAGATGATAGCAACAAAGAG 24 CTTTTAGTTTTTGAATCGT 19 129,46 108,86 36,52 27,31 0 0
new_miRc_236c MtChr4_12867124_12867209_1 new.3. TE+ GATTCAGATGATAGCAACAAAGAG 24 CTTTTAGTTTTTGAATCGT 19 129,34 107,9 36,52 27,31 0 0
new_miRc_236d MtChr7_11165290_11165375_1 new.3. TE+ TGATTCAGATGATAGCAACAAAGA 24 TTTTAGTTTTTGAATCGTT 19 86,83 86,83 10,26 7,43 0 0
new_miRc_236e MtChr7_28292853_28292936_0 new.3. TE+ ATTCAGATGATAGCAACAAAGAGC 24 CCTTTTAGCTTTTGAATTG 19 108,09 86,23 15,39 11,62 0 0
new_miRc_236h MtChr8_451975_452058_0 new.3. TE+ TGATTCAGATGATAGCAACAAAGA 24 TTTTAGCTTTTGAATCGTT 19 84,03 84,55 10,26 7,43 0 0
new_miRc_239a MtChr2_9594769_9594854_0 L.j.,G.m.,P.t. new.3. TE- GATGGAAGGAGAAGGAAGAAGATG 24 TTTTTTTGTTTCTGGGTTGATGTGTT 26 54,1 70,54 19,66 18,08 0 0
new_miRc_239b MtChr5_36715373_36715454_0 L.j.,G.m.,P.t. new.3. TE- GATGGAAGGAGAAGGAAGAAGATG 24 ATTTTTTTCTTCTTCTGGGTTGGTGT 26 62,77 67,66 19,66 18,08 0 0
new_miRc_240 MtChr3_20291631_20291713_1 new.3. TE- GAACATGATTATGATCGGATCTAC 24 AGATTTCATAAAACATGTTCAA 22 88,79 85,75 52,39 57,01 0 0
new_miRc_241 MtChr3_21016244_21016312_1 new.3. I+/TE+ CGAAATTGCAAGGCCGGACGTCAT 24 GAAGTCCTAGCTCAACTGGC 20 73,77 69,46 24,79 23,59 0 0
new_miRc_242 MtChr3_21879188_21879310_1 new.3. I- AGGTGGATGTGTCAGAATCACGGC 24 TGTGATTCTGACATATTCTCCTTA 24 24,43 23,95 5,74 5,39 0 0
new_miRc_243a MtChr3_26218561_26218654_0 L.j. new.3. I+/TE+/- ACACCTTATAAGTAAGAGGACTCA 24 GTGTCTCTCTTGCTTGTGTGATTGTTC 27 18,44 16,77 2,56 2,04 0 0
new_miRc_243b MtChr3_33454219_33454319_0 L.j. new.3. TE+ ACACCTTATAAGTAAGAGGACTCA 24 ATGTCTCTCTTGCTTGAGTGGTTGTTC 27 16,73 14,97 2,56 2,04 0 0
new_miRc_243c MtChr7_12675600_12675695_0 L.j. new.3. TE- ACACCTTATAAGTAAGAGGACTCA 24 GTGTCTATCTTGCTTGTGTGGTTGTTC 27 16,85 17,48 2,56 2,04 0 0
new_miRc_244 MtChr3_26323107_26323225_1 new.3. TE- ATGATCAGAGTCAGATTGCAGCGG 24 TCTTAAAAAATACTTTTTCTGATAAAAC 28 127,02 92,22 2,08 1,92 0 0
new_miRc_245 MtChr3_37161616_37161970_1 L.j. new.3. IG GAGAGAAGAAGGGAACATGATTTG 24 AATTATGTTCTCTTTTTCTATCAT 24 64,24 61,92 17,46 14,73 0 0
new_miRc_246a MtChr3_37412830_37412924_0 A.t. new.3. TE+ AAGTGGAAGGAAGAAGATGAAGAA 24 CTTAAATTTTTTCTGGATTTTT 22 69,61 80,48 9,65 6,11 0 0
new_miRc_246b MtChr5_31274297_31274404_1 A.t. new.3. TE+ AAGTGGAAGGAAGAAGATGAAGAA 24 CTTAATTTTTTTTCTGATTTT 21 69,74 80,48 9,65 6,11 0 0
new_miRc_246c MtChr5_31210345_31210452_1 A.t. new.3. TE+ AAGTGGAAGGAAGAAGATGAAGAA 24 CTTAATTTTTTTTCTGATTTT 21 69,74 80,48 9,65 6,11 0 0
new_miRc_246d MtChr8_13014698_13014788_0 A.t. new.3. TE+ AAGTGGAAGGAAGAAGATGAAGAA 24 CTTAAATTTTTTCTGCATTTTT 22 68,76 79,76 9,65 6,11 0 0
new_miRc_246e MtChr8_13157615_13157705_0 A.t. new.3. TE+ AAGTGGAAGGAAGAAGATGAAGAA 24 CTTAAATTTTTTCTGCATTTTT 22 68,76 79,76 9,65 6,11 0 0
new_miRc_246f MtChr8_9332603_9332693_1 A.t. new.3. UTR+/TE+ AAGTGGAAGGAAGAAGATGAAGAA 24 CTTAAATTTTTTCTGGATTTTT 22 70,71 81,44 9,65 6,11 0 0
new_miRc_248 MtChr3_39878731_39878873_1 new.3. TE+/- GACTAAATGTAGTAACGGTGAGAA 24 CTCACTGTTACTATATTTAGTCCT 24 346,36 312,45 87,93 71,62 0 0
new_miRc_250b MtChr6_5789132_5789219_1 new.3. IG TATCGGAAAGTATCGGATAATTAT 24 AATATTTGGATACTCTTCGGATACG 25 5,13 5,87 1,47 1,2 0 0
new_miRc_251a MtChr3_43480858_43480964_1 new.3. UTR-/TE- TGTGATTGAAAATACTGCGAGGCA 24 CCCAGTAGTTTTAGGTCCAAA 21 99,05 102,99 8,43 8,62 0 0
new_miRc_251b MtChr3_43465779_43465885_1 new.3. UTR-/TE- TGTGATTGAAAATACTGCGAGGCA 24 CCCAGTAGTTTTAGGTCCAAA 21 99,05 102,99 8,43 8,62 0 0
new_miRc_252 MtChr3_8483919_8484058_0 new.3. I+/TE- AGTGTAATTACAAGTGTCGGTGTC 24 CACTGACACGCCGACACATCTA 22 21,62 21,8 5,37 3,59 0 0
new_miRc_253 MtChr3_8504950_8505034_0 new.3. TE+/- CGGGACTAGCTAAAGACGTGGCCT 24 ACCGCGTTAGCTTGTCGCCTAA 22 6,96 10,3 3,91 4,91 0 0
new_miRc_254 MtChr4_18392876_18393091_1 new.3. TE- CGGAAAAGGACCAAGATGTGTAAC 24 TACACATTTTGGTCATTTCCATT 23 77,31 73,53 0,85 0,12 0 0
new_miRc_255a MtChr4_32793138_32793216_1 L.j. new.3. IG GATGGATTTTGTAGTGGATGGATT 24 TCCATTAACAAATTTTTTTGTTTG 24 19,91 28,38 4,4 3,71 0 0
new_miRc_255b MtChr5_8795821_8795910_0 L.j. new.3. IG GGATGGATTTTGTAGTGGATGGAT 24 CCATTAACAAATTTTTTTGTTTGA 24 66,81 100,6 10,01 26,23 0 0
new_miRc_255c MtChr5_9134797_9134893_0 L.j. new.3. TE+ GGATGGATTTTGTAGTGGATGGAT 24 CCATTTACAATTTTTTGTTGTTGGA 25 69,13 102,51 10,01 26,23 0 0
new_miRc_255d MtChr5_9134802_9134892_0 L.j. new.3. TE+ GGATGGATTTTGTAGTGGATGGAT 24 CCATTTACAATTTTTTGTTGTTGGA 25 69,13 102,51 10,01 26,23 0 0
new_miRc_255e MtChr5_9134840_9134938_0 L.j. new.3. TE+ GGATGGATTTTGTAGTGGATGGAT 24 TCATCCCTAGAAAAAAGTCCACTAG 25 67,29 99,88 10,01 26,23 0 0
new_miRc_255f MtChr6_14941215_14941302_1 L.j. new.3. TE+ TGGATGGATTTTGTAGTGGATGGA 24 CATTAACAAATTTTTTTGTTTGAT 24 48,36 79,88 10,26 14,01 0 0
new_miRc_256 MtChr4_34446634_34446920_1 new.3. TE- AAGAACCGGCTGCAGTTAACTGCC 24 TAGTAGTTAACTGCAGTCGGTTTATGA 27 18,2 17,25 3,18 3,71 0 0
new_miRc_257 MtChr4_8992657_8992776_1 new.3. TE- AGGTTGATGGAGATGATATGAAGA 24 TTAGTCATTTCCGTTAGTTTT 21 116,76 116,53 9,53 9,22 0 0
new_miRc_258 MtChr5_1195856_1195946_1 new.3. I- ACCGAGAGACTGGAGGGAGCGGAG 24 CTCTCTCTCTCTCTCTCGTTAG 22 4,89 2,87 1,59 0,24 0 0
new_miRc_259 MtChr5_15565252_15565339_0 new.3. TE- CCCACCAACCAATGAAAATGAGCA 24 CTTATATGTATTGGTTGGGATAAA 24 76,21 63,47 1,47 0,6 0 0
new_miRc_260 MtChr5_19253975_19254092_1 new.3. TE+ TCATGAACCTAACGAGCTGGACTT 24 GTTCAACTCGTTAGGTACATGAGA 24 23,45 19,76 6,11 4,79 0 0
new_miRc_261a MtChr5_34276062_34276156_0 new.3. I+/TE+ GAGGCTAGAACAACCGCACAAGCA 24 TATGTGTTTACTGTTGGGTCATGG 24 57,65 49,58 16,24 11,38 0 0
new_miRc_261b MtChr5_36015265_36015348_0 new.3. TE+/- AGGCTAGAACAACCACACAAGCAA 24 GTTGGGTTACTGGAGGAGCCGAG 23 41,04 40,72 11,97 10,9 0 0
new_miRc_261c MtChr5_41946320_41946443_0 new.3. TE- GAGGCTAGAACAACCGCACAAGCA 24 CTTGTAAGGTGTTCAACCTTTA 22 53,86 41,8 16,24 11,38 0 0
new_miRc_262 MtChr5_35104555_35104706_0 new.3. TE+/- GAAACAGGAGATGCTGGAACTGGC 24 TTCTGAAGTATGCTTCTGAAGTGT 24 5,62 6,47 1,71 2,51 0 0
new_miRc_263 MtChr5_36194469_36194956_1 new.3. I+ CTAGGAAATGGTTGTGGAAGAGGT 24 CTCTTCCTCAACCATTTCCTAGCT 24 29,56 30,66 5,5 11,74 0 0
new_miRc_264 MtChr5_38019579_38019660_1 new.3. IG TCCGTAGTAGCTCACCTGGCAAAA 24 TCCGGGTTCGACTCCCGGCTACGGAAT 27 43,6 47,31 9,16 10,66 0 0
new_miRc_266 MtChr5_565864_565994_1 new.3. TE- AATGTGTATTGGTTGGGATAAATT 24 TTTACCCACCAATCAATGA 19 73,28 64,31 0,98 2,16 0 0
new_miRc_267 MtChr5_762003_762096_1 new.3. IG GTTTAGATATACGGACGGATGGAG 24 CCCTCCGTCCTTGTATGTATGTAAGCAC 28 24,43 19,64 5,62 5,27 0 0
new_miRc_268 MtChr7_15372984_15373123_0 new.3. TE+ AGGAATCTGAAATTACAAGGACGT 24 GTCCTTGTAATTTCATATTCTTCC 24 56,06 53,29 24,67 23,83 0 0
new_miRc_270 MtChr7_22313164_22313249_1 new.3. TE- AGGTCCCTGACTGTGCATACTTAC 24 AAGTATGTACTCTCACTGAAGTCCCTGA 28 28,09 28,5 10,14 10,9 0 0
new_miRc_271 MtChr7_23426565_23426655_0 new.3. UTR+/TE- TGATTACGACATACTCTCTATCAT 24 GGTAGAGAGGGGGGATGAGAGAT 23 65,22 58,56 36,39 31,86 0 0
new_miRc_272 MtChr7_2407428_2407875_0 new.3. I+/E+ AGGAATTGAAAATGCAAATGGCTG 24 GCCATTCGAATTTTCAATTCCTTC 24 170,37 222,15 54,59 83,47 0 0
new_miRc_273 MtChr7_25057345_25057522_0 new.3. TE+ ACCAATGTCTGTAGAGCACCGGTT 24 CCAGTGTTCCAGAGACTTGGTTA 23 24,67 29,7 7,57 10,06 0 0
new_miRc_274 MtChr7_30485313_30485417_0 new.3. UTR+ GGCTAGGACTGCGAGAGACGACAC 24 GGTGTCTCCGTTCTTAGTACA 21 4,03 6,95 1,22 2,4 0 0
new_miRc_275 MtChr7_31869661_31869762_1 new.3. TE+/- AAAATTTAGTGACGGAATTAGAGA 24 ACTATATTTCCCTCACTAAATTTAGT 26 63,87 60,6 14,29 14,85 0 0
new_miRc_276 MtChr7_6520895_6521009_1 new.3. UTR+/TE+ ATTGTGGAGAAGTAGAGTGTCCGG 24 TCAAACTCTCTTCTTCTACTTTTT 24 19,54 21,2 2,56 2,63 0 0
new_miRc_277 MtChr7_6787209_6787357_0 new.3. TE+/- AGTTATGGGACTAAATTGAGACGG 24 GTCTCAATTTGGTCCCATAACTTT 24 17,59 16,29 1,1 1,56 0 0
new_miRc_278 MtChr7_7090170_7090429_1 G.m. new.3. TE- GAAAGGACCAAAATGTGTAACGGA 24 TGTTACACATTTTGGTCCTTTCCG 24 107,96 115,93 9,16 6,71 0 0
new_miRc_280 MtChr8_19469468_19469537_1 new.3. TE+ CGGATCTGCAACGTTGATGACGCC 24 AGTCATTGGTTGGATCTGCA 20 19,3 20,36 8,18 8,38 0 0
new_miRc_281 MtChr8_27814958_27815086_1 new.3. IG ACAAAGTAAGCTAGAGACACTCAT 24 GTTATTTAATTTGGTTTATGTTA 23 32,85 24,07 10,5 7,43 0 0
new_miRc_282 MtChr8_29119202_29119284_1 new.3. IG AAGTATCGGGCAGGTATCGGTGCA 24 CACCGCCTATCGTTCGTATTCC 22 18,69 30,18 1,71 4,43 0 0
new_miRc_283 MtChr8_4901220_4901301_1 new.3. IG GTAGGATAATGATCGGATACTCTC 24 GAAGTATCGGATAATTATTTTAAAA 25 6,11 5,87 2,93 3,11 0 0
new_miRc_2e MtChr5_41788515_41788663_0   new.1. TE+ ATGAAAGAATGATGGGTAATTTAC 24 AAATTACCCACCATTCTTCAAAG 23 17,95 20,36 4,52 3,71 0 0,12
a: Plant genome conatining at least one sequence with less than three mismatches. Lj: Lotus japonicus, Zm: Zea mays, Gm: Glycine max, Pt: Populus trichocarpa,  At: Arabidopsis thaliana
b: MiRDeep stringency criteria: 1: exact definition of mature start, precursor represents canonical hairpin, stringent read distribution pattern on precursor, 2: nonstrict/canonical hairpin:; 3: strict/non-canonical hairpin; 4: nonstrict/non-canonical hairpin 
c: IG: intergenic region; E: exon; I: intron; TE: transposable element, npc: non-protein coding gene, +: sense; -: antisense strand