New (miRBase annotated) miRNAs from M. truncatula. The names, sequences, sequence positions, lengths, the miRDeep stringency class, locus annotation are given.
miRBase ID mt3 coordinates conservation  (mature ≥8%) a prediction type b locus annotation c mature sequence mature length star sequence star length myc precursor  nm precursor  myc mature  nm mature  myc star  nm star 
mtr-miR156j MtChr1_3228440_3228542_0 Z.m.,L.j.,A.t.,G.m.,P.t. new.2. I+ TGACAGAAGAGGGTGAGCAC 20 GCTCATACTCTTCTGACAAT 20 4,03 5,27 3,42 3,95 0 0
mtr-miR159b AC233577_10385_10570_1 Z.m.,L.j.,A.t.,G.m.,P.t. plant.1. IG ATTGGAGTGAAGGGAGCTCCA 21 GGGCTCTCCGCACTCCAAGTC 21 143,75 182,04 117,49 137,25 0,61 1,08
mtr-miR160f AC233669_28227_28330_1 Z.m. plant.1. IG GCGTGAAGGGAGTCAAGCAGG 21 TGCCTGGCTCCCTGCATGCCA 21 5,62 0 3,42 0 2,08 0
mtr-miR168b MtChr5_42554714_42554809_0 Z.m. plant.2. npc+ TCGCTTGGTGCAGGTCGGGAA 21 CCTGCCTTGCATCAATCGAAT 21 4955,92 4201,78 4876,54 4124,9 0 0
mtr-miR171h MtChr3_31011259_31011367_0 Z.m.,L.j.,G.m. plant.1. IG CGAGCCGAATCAATATCACTC 21 GTGGTGTTGTTTCTGCTCATC 21 373,72 169,58 345,63 153,89 6,11 2,87
mtr-miR2111t MtChr7_14303598_14303684_1 G.m.,P.t. new.2. IG ATCCTTGGAATGCAGATTATC 21 TAATCTCCATCATGAGGTTTA 21 5,01 2,16 4,27 1,8 0 0
mtr-miR2111u MtChr7_14331003_14331118_1 A.t.,G.m.,P.t. plant.1. IG TAATCTGCATCCTGAGGTTTA 21 AGCCTTGGAGTGCAGATTATC 21 59,97 42,28 46,29 31,74 1,71 1,08
mtr-miR2586b MtChr8_26265721_26265793_0 L.j.,A.t. new.1. TE- CGGTGTCGTATCGGTGTTGGAC 22 CCGACACTGGGACACATGTC 20 4,52 3,47 1,47 1,2 0 0
mtr-miR2590g MtChr3_36080191_36080268_1 new.1. IG AAATGAGACTGAAATCTAAAGGTG 24 CCATGGGGTGGTGGGTGTTATGTAT 25 11,24 8,38 6,35 5,03 0 0
mtr-miR2590h MtChr3_26982633_26982830_0 new.3. IG AGAATGACATGGCAGAATAATCAC 24 GATTATTGTACCATGTCATTCTTG 24 97,22 85,39 40,3 32,34 0 0
mtr-miR2590i MtChr4_40862498_40862709_0 new.3. IG AGAATGACATGGCAGAATAATCAC 24 GATTATTGTACCATGTCATTCTTA 24 101,86 87,54 40,3 32,34 0 0
mtr-miR2590j MtChr7_31842658_31842870_0 new.3. I+ AGAATGACATGGCAGAATAATCAC 24 GATTATTGTGCCATGTCATTCTTG 24 107,23 92,22 40,3 32,34 0 0
mtr-miR2592aa AC148178_74390_74563_1 new.2. IG CAACAGGACTCAAGCATTTCGC 22 GAATGCTGGAGTCCTGCCGAT 21 55,94 42,16 18,93 14,49 0 0
mtr-miR2592ab MtChr1_27380832_27381076_1 new.2. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCGTGACTCATGTTGTT 22 59,11 41,92 18,93 14,49 0 0
mtr-miR2592ac MtChr1_3801357_3801776_1 new.2. IG CAACAGGACTCAAGCATTTCGC 22 GAATGTTGAGGACTTGTCGTT 21 61,19 43,95 18,93 14,49 0 0
mtr-miR2592ad MtChr3_26917562_26917791_0 new.2. IG CAACAGGACTCAAGCATTTCGC 22 CAGATGTTGGAGTCATGCCGTT 22 55,81 41,44 18,93 14,49 0 0
mtr-miR2592ae MtChr3_38119156_38119503_0 P.t. new.2. IG CAACAGGACTCAAGCATTTCG 21 AAATGCTCGAGTTATGGCCGTT 22 24,18 17,13 18,32 11,14 0 0
mtr-miR2592af MtChr4_21301218_21301451_1 new.2. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCATAGCCGTT 23 56,91 42,99 18,93 14,49 0 0
mtr-miR2592ag MtChr4_21301408_21301586_1 new.2. IG CAACAGGACTCAAGCATTTCGC 22 GAATGTTGGAGTCCTGCCGAT 21 56,42 42,04 18,93 14,49 0 0
mtr-miR2592ah MtChr5_28309823_28310169_1 new.2. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTCGAGTCCTGTTGTT 22 59,23 45,39 18,93 14,49 0 0
mtr-miR2592ai MtChr5_8437739_8438086_0 new.2. TE+ CAACAGGACTCAAGCATTTCGC 22 GAAATGCTCGAGTCTTGTTGTT 22 58,74 45,51 18,93 14,49 0 0
mtr-miR2592aj MtChr6_1271676_1272017_0 new.2. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTCGAGTCCTGTTGTT 22 58,62 43,95 18,93 14,49 0 0
mtr-miR2592ak MtChr7_11280241_11280414_0 new.2. IG CAACAGGACTCAAGCATTTCGC 22 TGAATGTTGGAGTCCTGCTGAT 22 56,55 41,8 18,93 14,49 0 0
mtr-miR2592al MtChr7_11280317_11280669_0 new.2. IG CAACAGGACTCAAGCATTTCGC 22 CAAATGCTTGAGTCATGGCCGTT 23 59,11 43,83 18,93 14,49 0 0
mtr-miR2592am MtChr8_25924098_25924342_1 new.2. CAACAGGACTCAAGCATTTCGC 22 AAAATGCTTGAGTCATGGTCGTT 23 57,52 42,16 18,93 14,49 0 0
mtr-miR2592an MtChr2_26330086_26330320_0 P.t. new.1. TE- AAATGCTTGAGTCCTGTTGTT 21 CAACAGGACTCGAGCATTTCG 21 8,67 9,46 2,56 2,99 0,49 0,6
mtr-miR2592ao MtChr5_24806654_24806826_1 P.t. new.1. IG AAATGCTTGAGTCCTGTTGTT 21 CAGCAGGACCCCAATATTCGA 21 5,25 5,39 2,56 2,99 0 0
mtr-miR2592ap AC146550_50348_50699_1,AC235665_89187_89538_0 Z.m. new.1. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAGCCTAA 22 112,6 98,44 94,9 82,87 0,24 0
mtr-miR2592aq MtChr3_12569606_12569954_1 Z.m. new.1. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAGCCTAA 22 113,21 98,8 94,9 82,87 0,24 0
mtr-miR2592ar MtChr3_24792765_24792867_0 Z.m. new.1. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAGCCTAA 22 104,3 90,18 94,9 82,87 0,24 0
mtr-miR2592as MtChr3_35022640_35023051_0 Z.m. new.1. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAGCCTAA 22 116,15 101,92 94,9 82,87 0,24 0
mtr-miR2592at MtChr3_36153880_36153982_0 Z.m. new.1. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAGCCTAA 22 106,13 92,45 94,9 82,87 0,24 0
mtr-miR2592au MtChr3_37481940_37482039_1 Z.m. new.1. TE- AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAGCCTAA 22 106,86 92,1 94,9 82,87 0,24 0
mtr-miR2592av MtChr4_15025537_15025636_1 Z.m. new.1. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAGCCTAA 22 104,67 91,38 94,9 82,87 0,24 0
mtr-miR2592aw AC225526_54370_54602_0 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 CCAACGTCTAAAGCACGCCTAA 22 111,5 97,6 94,9 82,87 0 0
mtr-miR2592ax MtChr2_28007250_28007349_1 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAACCCAA 22 105,76 91,86 94,9 82,87 0 0
mtr-miR2592ay MtChr3_19263498_19263924_1 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCACACCTAA 22 120,05 105,03 94,9 82,87 0 0
mtr-miR2592az MtChr5_11213690_11213922_0 Z.m. new.2. TE- AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCACGCCTAA 22 115,05 101,32 94,9 82,87 0 0
mtr-miR2592ba MtChr5_38350277_38350511_0 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 CCAGCGTCTAAAGCACACCTAA 22 112,6 99,16 94,9 82,87 0 0
mtr-miR2592bb MtChr6_1204144_1204496_0 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATTTAATCCCAGCTTAA 22 111,99 97,13 94,9 82,87 0 0
mtr-miR2592bc MtChr6_18802183_18802284_1 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 TCATCATCTAAAGCAAGCCTAA 22 106,62 92,1 94,9 82,87 0 0
mtr-miR2592bd MtChr7_11678637_11678855_1 Z.m. new.2. TE- AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAACACGCCTAA 22 111,87 98,92 94,9 82,87 0 0
mtr-miR2592be MtChr7_19749083_19749509_0 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAGCATAA 22 119,81 105,63 94,9 82,87 0 0
mtr-miR2592bf MtChr7_27232381_27232809_1 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 CCATCATCTAAAGCAAACCTAA 22 114,92 100,24 94,9 82,87 0 0
mtr-miR2592bg MtChr7_28360891_28360997_0 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 TCATCATCTAAAGCAAGCCTAA 22 107,23 92,57 94,9 82,87 0 0
mtr-miR2592bh MtChr8_22329223_22329454_1 Z.m. new.2. IG AGGCTGGTTTAGATGAAGGTA 21 CCAACGTCTAAAGCACGCCTAA 22 111,14 97,48 94,9 82,87 0 0
mtr-miR2592bi AC225507_75773_75963_0 G.m. new.2. IG TGGAACATTGGGAATGCCGGT 21 CCGCATTCCCATTGTCCCTGT 21 5,74 4,79 2,93 3,47 0 0
mtr-miR2592bj MtChr2_29295100_29295290_0 G.m. new.2. IG TGGAACATTGGGAATGCCGGT 21 CGGAATTCCCACTGTTCCTGT 21 6,47 5,87 2,93 3,47 0 0
mtr-miR2592bk MtChr3_37389041_37389231_1 G.m. new.2. IG TGGAACATTGGGAATGCCGGT 21 TGGCATTCCCATTGTTCCTGT 21 4,27 4,19 2,93 3,47 0 0
mtr-miR2592d MtChr3_29511917_29512147_1 new.1. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTGTT 22 58,74 43,95 18,93 14,49 0 0
mtr-miR2592e MtChr8_36566754_36566934_1 new.2. IG CAACAGGACTCAAGCATTTCGC 22 GAATACTGGAGTCCTGCCGAT 21 55,94 42,16 18,93 14,49 0 0
mtr-miR2592o MtChr8_23562095_23562330_0 new.1. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTGTT 22 59,36 46,95 18,93 14,49 0 0
mtr-miR2592q MtChr8_36566509_36566856_1 new.1. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTGTT 22 61,55 47,9 18,93 14,49 0 0
mtr-miR2592t MtChr3_38781668_38781898_1 new.1. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTATT 22 56,42 41,56 18,93 14,49 0 0
mtr-miR2592u MtChr2_12961048_12961265_0 new.4. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTGTT 22 63,02 48,86 18,93 14,49 0 0
mtr-miR2592v MtChr2_4432365_4432582_1 new.4. I+ CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTGTT 22 63,02 48,86 18,93 14,49 0 0
mtr-miR2592w MtChr7_4319775_4319992_1 new.4. I+ CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTGTT 22 63,02 48,86 18,93 14,49 0 0
mtr-miR2592x MtChr8_594871_595088_1 new.4. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTGTT 22 63,02 48,86 18,93 14,49 0 0
mtr-miR2592y MtChr8_496186_496403_1 new.4. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTTGAGTCCTGTTGTT 22 63,02 48,86 18,93 14,49 0 0
mtr-miR2592z AC148178_74141_74488_1 new.2. IG CAACAGGACTCAAGCATTTCGC 22 GAAATGCTCGAGTCCTGTTGTT 22 58,74 45,51 18,93 14,49 0 0
mtr-miR2600b CU571152_117865_117949_0 new.3. I-/TE- AAGCATTGTGGCATTGTGATTGGT 24 CAATCACAATGTCCCAATGCTTGT 24 17,83 21,68 10,75 13,53 0 0
mtr-miR2600c MtChr1_30504775_30504859_1 new.3. TE- AAGCATTGTGGCATTGTGATTGGT 24 CAATCACAATGTCACAATGCTTGT 24 21,98 28,14 10,75 13,53 0 0
mtr-miR2600d MtChr2_31931259_31931343_1 new.3. TE- AAGCATTGTGGCATTGTGATTGGT 24 CAATCATAATGTCACAATGCTTGT 24 21,74 27,9 10,75 13,53 0 0
mtr-miR2600e MtChr3_1834018_1834151_1 new.3. I-/TE+ AAGCATTGTGGCATTGTGATTGGC 24 CAATCACAATGCCACAATGTTTGT 24 18,44 25,99 7,33 12,46 0 0
mtr-miR2606d MtChr4_34717659_34717794_0 G.m. new.1. TE+ AGTTAAGAACCATACAAAAAACAC 24 GTACTTTTTGTATGGTTCTTAACTAA 26 4,27 3,83 1,95 2,04 0 0
mtr-miR2629h MtChr3_38782731_38782824_0 new.1. TE+ GCAGAAGATCCTCGGCAGTTAACT 24 TTAACTGCCGAAGAAAACTGTCG 23 5,62 7,07 3,05 2,16 0 0
mtr-miR2643b MtChr5_41836460_41836549_1 L.j.,G.m.,P.t. new.2. IG TTTGGGATCAGAAATTAGAGA 21 TCTAATCTCTGTTCCCAATTA 21 15,75 13,29 15,02 11,86 0 0
mtr-miR2670e MtChr2_18370320_18370524_1 A.t. new.1. IG TCTCAACAGGACGGATCACTA 21 GTGGTCCGTTAGGTTGGGGAA 21 98,8 75,33 34,44 24,19 0 0
mtr-miR2670f AC235487_136435_136637_1 P.t. new.2. E+/I+ AGTGGTCTGTTAGGTTGGGGA 21 CCCAACATGACAGATCACTAT 21 3,91 3,71 1,34 1,92 0 0
mtr-miR2670g MtChr5_7523719_7523920_1 P.t. new.2. E+ AGTGGTCTGTTAGGTTGGGGA 21 CCCAACATAACAGATCACTAT 21 3,91 3,95 1,34 1,92 0 0
mtr-miR399r MtChr4_32756744_32756845_0 Z.m.,L.j.,A.t.,G.m.,P.t. plant.2. npc+ TGCCAAAGAAGATTTGCCCCG 21 GGGCAATGACTTTTTTTGGCAGT 23 10,01 8,62 8,06 6,95 0 0
mtr-miR4414a MtChr1_30518812_30518915_0 G.m. new.1. I+ AGCTGCTGACTCGTTGGTTCA 21 ATCCAACGATGCGGGAGCTGC 21 135,56 222,75 124,69 206,23 2,81 5,15
mtr-miR4414b MtChr3_19914568_19914674_0 A.t.,G.m.,P.t. new.1. IG TGTGAATGATGCGGGAGCTAA 21 AGCTGCTGACTCATTCATTCA 21 28,94 29,46 16,49 17,37 8,18 8,62
mtr-miR482 AC235678_65790_65893_0 P.t. new.2. IG GGCATGGGATAGTAGGGAAGA 21 TTCTTACCTACACCTCCCATGCCTA 25 732,54 536,76 308,5 222,87 0 0
mtr-miR5204 MtChr7_20898038_20898117_0 G.m. new.1. E- GCTGGAAGGTTTTGTAGGAAC 21 TCCCTCAAAGGCTTCCAGTAT 21 43,6 1,92 36,27 1,68 0,73 0
mtr-miR5205a MtChr8_20140727_20140803_1 Z.m.,G.m. new.2. TE+/TE- CATACAATTTGGGACGGAGGGAG 23 TGATTCTCTTAAGTATGTGGAAT 23 12,58 11,14 3,66 2,04 0 0
mtr-miR5205b MtChr3_7621934_7622016_0 Z.m.,G.m. new.3. TE+ CTTATAATTAGGGACGGAGGGAGT 24 TCATTACTACCCTACTTTAAAAGAT 25 63,87 61,2 16,12 11,98 0 0
mtr-miR5205c MtChr6_9127590_9127732_1 L.j.,G.m. new.3. TE- CTTATAATTAGGGACGGAGGTAGT 24 TCTCTTTGTCTTTTATTATGTTAG 24 54,71 62,63 11,6 15,57 0 0
mtr-miR5205d MtChr8_29991161_29991227_1 L.j.,G.m. new.3. TE- CTTATAATTAGGGACGGAGGTAGT 24 TCTCTCCGTCCCTTTTTATAGGAG 24 52,15 61,08 11,6 15,57 0 0
mtr-miR5206 MtChr7_20866117_20866242_1 new.1. IG ATGGGATCCTGTTGGTGGGTTAC 23 AACCCTCAAAGGCTTCCATGG 21 4,15 0,6 3,66 0,12 0,37 0,36
mtr-miR5207 MtChr1_22235128_22235243_1 new.2. IG CATTAATGTGGGTTTGGACGGTT 23 CTTGTTTTAGGCTATAAATAGGC 23 5,62 6,83 2,08 2,04 0 0
mtr-miR5208a AC151525_13620_13707_0 new.2. TE- AACATGGATGTTGTGAGTTTGTT 23 TACGGTCATATTAGCCATATTAG 23 7,21 7,54 0,61 2,28 0 0
mtr-miR5208b MtChr5_3616490_3616554_0 new.2. TE- AACATGGATGTTGTGAGTTTGTT 23 TAGATTCATTCCTTTTTGTTTT 22 5,13 5,03 0,61 2,28 0 0
mtr-miR5208c MtChr8_32272675_32272738_0 new.2. TE+/- AACATGGATGTTGTGAGTTTGTT 23 CAAATTCATACTTTTTGTTTT 21 6,6 6,71 0,61 2,28 0 0
mtr-miR5208d MtChr5_25763728_25763810_1 new.1. TE- CATATTAGTCATATTTGTAGGCAT 24 GCTATTAACATGGATGATGTGAG 23 12,82 11,14 6,84 4,67 0,24 0,12
mtr-miR5209 MtChr7_15324398_15324507_0 new.2. TE- CGAGGAGGCGGTATTGTTTGAA 22 GGGATCAAACTGTTGTCTTTGA 22 26,99 21,68 11,11 8,86 0 0
mtr-miR5210 MtChr3_22378945_22379061_0 G.m.,P.t. new.3. IG TAAATGTGTTGGAATTAAGGTT 22 CCTTGACCCGCACATTTAGC 20 15,75 12,46 15,02 11,74 0,12 0
mtr-miR5211 MtChr6_2172806_2172919_0 new.3. IG TCGCAGGAGTGATGGGACCGGC 22 TGGTGCCATCCTCCTGCGACA 21 571,45 406,94 524,55 352,09 2,44 3,47
mtr-miR5212 MtChr2_10428655_10428738_1 G.m. new.1. IG TGGATTTCGTATTTCTTTGGTA 22 CCAAGGAAATAGATATCCAGC 21 4,76 2,4 3,91 1,68 0,37 0,6
mtr-miR5213 MtChr2_16737674_16737786_0 L.j.,G.m.,P.t. new.1. IG TACGTGTGTCTTCACCTCTGAA 22 CAGAGTGCAGATACACGCATC 21 1288,84 1061,07 1038,96 625,99 9,65 9,94
mtr-miR5214 MtChr3_1410979_1411077_1 new.1. IG TGATAGAGCTAGACCATCGGAG 22 CCGTAGTCTAGCTCTATTAAC 21 393,63 256,41 370,54 240,96 0,37 0,12
mtr-miR5215 MtChr8_17750441_17750526_1 new.1. E- AGGAGGATGAGCTACCTGCTT 21 ACAGTAAACGCTTCCTTTCTTG 22 641,79 467,78 409,26 301,08 0,24 0,12
mtr-miR5216a AC135504_40585_40716_1 new.4. TE- TTAGGAGTGAAAAACGGTGGAA 22 TTGCCGTTGCTTGAGTCAAAGTAATA 26 13,92 18,08 4,76 6,47 0 0
mtr-miR5216b MtChr2_14110668_14110824_0 new.4. TE- TTAGGAGTGAAAAACGGTGGAA 22 TTGCCGTTGCTTGAGTCAAAGTAGTA 26 18,08 21,56 4,76 6,47 0 0
mtr-miR5217 MtChr7_9142557_9142708_1 new.4. TE- AGGTCATTTTGAACGGTCGGAT 22 TCGTCCGATCAAGCTTGTACCTCT 24 8,06 13,53 1,34 1,2 0 0
mtr-miR5218 MtChr3_13859336_13859401_0 new.2. TE- TGAGACTTGGTAGTAAGATGAT 22 AGTCTTGAGATAGAGGTCTTTAGCA 25 23,08 16,65 14,04 8,74 0 0
mtr-miR5219a MtChr1_9855757_9855840_1 G.m. new.2. E+ TCATGGAATCTCAGCTGCTGCA 22 TACCGGCAGAGATTTTTCCGGCT 23 1,59 4,79 0,85 1,68 0 0
mtr-miR5219b MtChr1_9895147_9895230_1 G.m. new.2. E+ TCATGGAATCTCAGCTGCTGCA 22 TACCGGCAGAGATTTTTCCGGC 22 1,59 4,79 0,85 1,68 0 0
mtr-miR5221 MtChr5_26032432_26032531_0 new.2. I+ AGGAGAGATGGTGTTTTGACTT 22 TTCAAATATCATCATCTGCCTGC 23 3,66 2,87 1,95 1,68 0,12 0,12
mtr-miR5222 MtChr6_11745433_11745538_0 Z.m. new.2. I+ TTACAGGAGAAGAATGTATGGC 22 CATATAAGTTTTTCCTTTATTA 22 33,71 32,45 6,72 8,74 0 0
mtr-miR5223a MtChr6_16364129_16364440_1 new.2. IG CGTGGAATTTACTTGAAGATGC 22 ATCTTAAATAAATTCAACGCA 21 5,86 4,91 2,2 1,56 0 0
mtr-miR5223b MtChr6_16435556_16435683_1 new.2. IG CGTGGAATTTACTTGAAGATGC 22 ATCTTAAATAAATTCAACGCA 21 5,86 4,91 2,2 1,56 0 0
mtr-miR5224a MtChr6_21605894_21605989_1 G.m. new.2. E- TCGAGGACATGAGGGACGTTAT 22 AACGTCCGATCTGGGAGCTTCCTCATA 27 4,15 2,87 2,44 1,44 0 0
mtr-miR5224b MtChr8_20688277_20688367_1 new.2. TE- CGGAAGAGGATTGTCGAGGACA 22 TCCTCATATACCTCAATCATG 21 8,67 10,18 3,3 3,23 0 0
mtr-miR5225 MtChr6_2176473_2176574_0 L.j.,A.t.,G.m.,P.t. new.2. IG TCAGTCGCAGGAGAGATGACAC 22 GTCATCTTTCTTCGACTGAAG 21 2,81 4,07 1,34 1,56 0 0
mtr-miR5226 MtChr7_1278707_1278779_1 G.m. new.2. TE- TTTGTACAACTTGGAGGATTCA 22 TCTTCTCTAACTCGTGCATTCG 22 31,75 30,78 22,47 23,71 0 0
mtr-miR5227 MtChr8_32034000_32034512_1 L.j.,A.t.,G.m.,P.t. new.2. I+ TGAAGAGAAGAAGATTGATGAA 22 CGTTAATCTTCTTCTCTTCAAT 22 3,42 4,19 1,47 1,2 0 0
mtr-miR5228 MtChr4_2096381_2096533_0 L.j.,G.m. new.1. E+  TCTGGTGTACAACTTGATGGA 21 CATTGAGTTAGAAAACAGCAGTGT 24 15,39 7,9 7,69 3,35 0 0
mtr-miR5229a MtChr5_11362838_11362926_0 G.m. new.1. I+ TTAGCAGGAAGAGTGACTATG 21 TAGTCACTCTTCCTGTTAACC 21 110,53 1,2 98,93 0 0,24 0
mtr-miR5229b MtChr5_11407192_11407280_0 G.m. new.1. E+/I+ TTAGCAGGAAGAGTGACTATG 21 TAGTCACTCTTCCTGTTAACC 21 110,53 1,2 98,93 0 0,24 0
mtr-miR5230 MtChr7_4916960_4917091_0 G.m. new.1. E+ CAAATCTTGAATCGATTGGCA 21 TGAATGGTTTAAGATATTGGA 21 15,39 9,82 9,65 6,71 0 0,12
mtr-miR5231 MtChr7_857949_858052_0 P.t.,L.j.,A.t. new.1. I+/TE+ TTATGCAAGTAGATAAGCTCA 21 AGCTTATGTATTGGCATAAGA 21 37,62 22,87 30,53 18,44 0 0,12
mtr-miR5232 AW736385.1_97_227_0 new.4. TACATGTCGCTCTCACCTGAA 21 AAGGAGCCATGAGAGTTGGCATTACC 26 203,59 111,86 110,16 54,73 0 0
mtr-miR5233 AC233668_221685_221750_1 G.m. new.2. E+ GAGGAGGATGGCCGTCTGGAC 21 CCAGACAATATGGCCCCTGATATTAC 26 7,57 5,87 5,74 4,07 0 0
mtr-miR5234 MtChr3_12160071_12160206_0 L.j.,A.t.,G.m.,P.t. new.4. E+ TTTTGTTGTGGATGGCAGAAG 21 TCTTTGTTTCTGACATATC 19 32,12 30,06 11,72 10,42 0 0
mtr-miR5235a MtChr4_27500659_27500752_1 new.4. E+/I+/TE+ ATAAGGTCAATGATTGGCGTG 21 TGCTTGAATCAGAACTCGTGGA 22 5,74 7,78 3,79 6,47 0 0
mtr-miR5235b MtChr8_8875197_8875290_1  new.4. E+/I+/TE+ ATAAGGTCAATGATTGGCGTG 21 TGCTTGAATCAGAACTCGTGGA 22 5,74 7,78 3,79 6,47 0 0
mtr-miR5236a MtChr5_22052030_22052139_0 new.4. I+/TE+ TGAATTTCGGGCAGATTTGGT 21 CAAACATGCAGTTCAAC 17 74,62 70,3 31,88 25,75 0 0
mtr-miR5236b MtChr5_22038387_22038496_0 new.4. I+/TE+ TGAATTTCGGGCAGATTTGGT 21 CAAACATGCAGTTCAAC 17 74,62 70,3 31,88 25,75 0 0
mtr-miR5236c MtChr5_22165716_22165825_1 new.4. I+/TE+ TGAATTTCGGGCAGATTTGGT 21 CAAACATGCAGTTCAAC 17 74,62 70,3 31,88 25,75 0 0
mtr-miR5236d MtChr5_22163125_22163234_1 new.4. I+/TE+ TGAATTTCGGGCAGATTTGGT 21 CAAACATGCAGTTCAAC 17 74,62 70,3 31,88 25,75 0 0
mtr-miR5236e MtChr5_22142517_22142626_1 new.4. I+/TE+ TGAATTTCGGGCAGATTTGGT 21 CAAACATGCAGTTCAAC 17 74,62 70,3 31,88 25,75 0 0
mtr-miR5237 MtChr6_21567824_21567992_0 G.m.,P.t. new.4. E+/I+/TE- TTCAAAAGATTTAGTTGGGAT 21 TCAAACTATTTTTTTTTGTTTT 22 13,43 10,06 6,35 2,87 0 0
mtr-miR5238 AC159090_91612_91701_0 L.j.,G.m.,P.t. new.2. E+/TE+ TGTAGAAAAAACAAAGGGCAA 21 GATCCTTTTCATGTTCGACACC 22 119,08 73,29 109,43 66,35 0 0
mtr-miR5239 BE999124.1_388_496_0 L.j.,G.m. new.2. TGGGAGAAAAGATAGAATGTG 21 CGTTCTATATTTTCTCCCACC 21 112,73 133,29 76,21 71,5 0 0
mtr-miR5240 MtChr1_10087411_10087479_0 L.j.,G.m.,P.t. new.2. npc+ TTGAAAAAATTGTGGATTTGA 21 GCTTCCACAATATTAATC 18 10,75 6,71 5,01 3,23 0 0
mtr-miR5241a MtChr2_12975324_12975398_0 Z.m. new.2. E+ TGACTGAATGGAAGAGTGCAT 21 GGGCTCATTTTTGTTTGGTTGTA 23 38,84 39,28 12,34 13,05 0 0
mtr-miR5241b MtChr6_21577926_21577989_0 Z.m. new.2. E+ TGACTGAATGGAAGAGTGCAT 21 GGGCTCATTTTTGTTCGGTCGTA 23 39,57 39,28 12,34 13,05 0 0
mtr-miR5241c MtChr6_21590440_21590555_0 Z.m. new.2. E+ TGACTGAATGGAAGAGTGCAT 21 GGGCTCATTTTTGTTTGGTCGTA 23 45,68 45,63 12,34 13,05 0 0
mtr-miR5242 MtChr2_13188883_13188948_1 G.m.,P.t. new.2. E-/TE- TTGTAGAAACAAGCGATGTCA 21 GCATAGCTCATTTCATAAGA 20 4,03 3,23 1,59 0,84 0 0
mtr-miR5243 MtChr2_13249735_13249882_0 L.j.,G.m. new.2. E+/TE+ TGGGCAGAGAAATCGTGAGGC 21 CTACATGGTTTTAGTGCTGAAA 22 8,79 6,83 2,32 2,51 0 0
mtr-miR5244 MtChr3_10741496_10741579_0 Z.m.,L.j.,G.m. new.2. E+ TATCTCATGAAGATTGTTGGT 21 CAACAAAAAGTTGCAGAGGTGGC 23 28,46 16,17 22,84 11,14 0 0
mtr-miR5245 MtChr4_2076009_2076071_0 G.m. new.2. E-/TE+ CATCGTAGAACACAGGCAGTA 21 CTGGCCTGTGGTTCTGTGACGCA 23 6,11 6,83 1,95 2,04 0 0
mtr-miR5246 MtChr4_32753336_32753405_1 Z.m.,G.m. new.2. E+/TE+ TTGCAGACAGCTTTGAAGGTT 21 CTTGATCTGGCTGTTTATAATT 22 7,94 4,91 6,96 4,31 0 0
mtr-miR5247 MtChr4_4492964_4493095_1 Z.m.,P.t. new.2. E+/I+ GCAGGAGCAAGCATCTGATGA 21 GTTAGATCTGTTCTTACCA 19 6,72 4,07 3,3 1,68 0 0
mtr-miR5248 MtChr4_5638886_5639005_1 Z.m.,L.j.,A.t.,G.m.,P.t. new.2. E+/TE+ TTTTTAGTTGGCATGCATTCA 21 CCGGTAGCTCTTGAAATCC 19 12,58 13,05 6,11 4,07 0 0
mtr-miR5249 MtChr4_593193_593436_1 P.t. new.2. I-/TE+/- ACTTAGGGGGCAGTTTTGTAG 21 ACAAAACAGCCTCCTATGTAT 21 5,74 3,35 3,05 1,56 0 0
mtr-miR5250 MtChr5_28961519_28961634_1 new.2. IG TGAGAATGTTAGATACGGAAC 21 TCTTCATCTAACATTCTGGAA 21 262,82 153,41 223,01 123,11 0 0
mtr-miR5251 MtChr5_29855465_29855578_0 A.t. new.2. E+/TE+ AGTAGATCTAGTTGGTGTCTT 21 GTTATACCAATATTTTACCAT 21 25,53 21,8 16,12 13,05 0 0
mtr-miR5252 MtChr5_29857114_29857208_1 G.m. new.2. E-/TE- TGAGAGCTCACTGAAGTCTGC 21 AGTCCTCCACAGTACTTAAT 20 16 14,49 9,28 7,54 0 0
mtr-miR5253 MtChr6_13020994_13021232_1 Z.m.,L.j.,A.t.,G.m.,P.t. new.2. IG GATGAAAATGATTATGTTGGA 21 CAACATAATCATTTTCATATT 21 154,74 129,7 68,15 47,54 0 0
mtr-miR5254 MtChr6_14276428_14276521_0 G.m.,P.t. new.2. I+ AGGAGGTGGAAGCATTTGTGA 21 ACAATGCCTTTCCAGTTTAGCA 22 20,15 16,29 5,5 3,47 0 0
mtr-miR5255 MtChr6_14382057_14382144_1 G.m.,P.t. new.2. E+/TE+ TGACTTGATAGAGGACATGGG 21 AATGTCTCATATATCAATCTTA 22 8,55 9,22 2,93 2,04 0 0
mtr-miR5256 MtChr6_9803402_9803523_0 L.j.,A.t.,G.m.,P.t. new.2. E+/TE+ TAATGGATTATGTAAGATTAA 21 TATCTTACAACACTCTTATTGAT 23 31,88 15,81 12,34 6,95 0 0
mtr-miR5257 MtChr7_18960254_18960386_1 Z.m.,P.t. new.2. E-/TE- ACAAGTAGAACCTTTTTTCTG 21 GAAAGAAGTTGTCTTTGTAA 20 4,15 3,83 3,54 2,99 0 0
mtr-miR5258 MtChr7_19225578_19225684_1 G.m. new.2. E-/TE- TCAAGTGACAAGGAAGATCTT 21 GATAAGTTCCATATGTCACTATTCA 25 12,82 12,69 4,64 4,79 0 0
mtr-miR5259 MtChr7_6751223_6751314_1 new.2. I+ CAAGGGGTATTGCGGAGGATA 21 TCTTCCGAAACTCTCCCTTGTA 22 7,57 8,5 6,47 6,95 0 0,12
mtr-miR5260 MtChr8_17750264_17750350_1 Z.m.,A.t.,G.m. new.2. E- TTTGTATTGTTGACATGGCTT 21 TATATTTCTAACAATACAAAAA 22 1459,7 1109,58 1347,46 1020 0 0
mtr-miR5261 MtChr8_2125034_2125099_0 Z.m.,L.j.,G.m.,P.t. new.2. E- TCATTGTAGATGGCTTTGGCT 21 TACAATCAAATCTACGATGAAT 22 9,53 7,43 5,25 3,47 0 0,12
mtr-miR5262 MtChr8_25436109_25436193_0 L.j. new.2. I- TCTGTCAGTAGACTCAATTTC 21 AATTGAGTCTATTGACAGATA 21 8,79 6,59 7,08 5,03 0 0
mtr-miR5263 MtChr8_27509961_27510064_0 G.m. new.2. TE+ TGACTAAAACTAGTAACGGGG 21 CCATTACTAGTTTTAGTCCTT 21 3,42 4,43 2,08 1,68 0 0
mtr-miR172b AC235487_197953_198066_0 plant.3. IG AGAATCTTGATGATGCTGCAT 21 GTAGCATCATCAAGATTCATA 21 1042,99 1125,98 1009,28 1088,62 2,32 1,44
mtr-miR172b AC233663_10169_10307_0 Z.m.,L.j.,A.t.,G.m.,P.t. plant.1. IG AGAATCTTGATGATGCTGCAT 21 GTAGCATCATCAAGATTCACA 21 1044,7 1130,89 1009,28 1088,62 0,24 0
mtr-miR5264 MtChr3_17525745_17525851_1 Z.m. new.1. I+ TTGATCAAGGACTTTGCATC 20 TGCAAAGTCTTACTTGATCAACA 23 18,44 15,81 10,75 10,3 0 0
mtr-miR5265 AL368609.1_367_478_0 new.4. AAGTGATGTTGGAATGGTTA 20 ACCACTCACAATGTTATATTTCG 23 6,96 9,34 0,85 2,16 0 0
mtr-miR5266 MtChr5_22142686_22142758_1 Z.m. new.2. I+/TE+ CTGGGGGACTGTCTGGGGCG 20 GCCCAGGCAGCCCCCAGCC 19 7,21 13,29 3,18 6,47 0 0
mtr-miR5267a MtChr8_12876393_12876458_1 new.1. TE- AGGCATTTGCTAGAATACACCCAC 24 AGGAGTATTTTAGCAAATGAATAA 24 11,48 13,77 8,55 10,78 0 0
mtr-miR5267b MtChr3_1054089_1054154_0 new.1. IG AGGCATTTGCTAGAATACACCCAC 24 AGGAGTATTTTAGCAAATGAATAA 24 11,48 13,77 8,55 10,78 0 0
mtr-miR5267c MtChr6_18268746_18268811_0 new.1. TE+ AGGCATTTGCTAGAATACACCCAC 24 AGGAGTATTTTAGCAAGTGAATAA 24 13,19 15,45 8,55 10,78 1,59 1,08
mtr-miR5267d MtChr2_26223463_26223528_1 new.1. TE+ AGGCATTTGCTAGAATACACCCAC 24 AGGAGTATTTTAGCAAGTGAATAA 24 13,19 15,45 8,55 10,78 1,59 1,08
mtr-miR5267e MtChr3_9786008_9786073_0 new.1. TE+ AGGCATTTGCTAGAATACACCCAC 24 AGGAGTATTTTAGCAAGTGAATAA 24 13,19 15,45 8,55 10,78 1,59 1,08
mtr-miR5267f MtChr1_32734740_32734805_0 new.1. I-/TE- AGGCATTTGCTAGAATACACCCAC 24 AGGAGTATTTTAGCAAGTGAATAA 24 13,07 14,97 8,55 10,78 1,59 1,08
mtr-miR5267g MtChr1_32657933_32657998_0 new.1. I-/TE- AGGCATTTGCTAGAATACACCCAC 24 AGGAGTATTTTAGCAAGTGAATAA 24 13,07 14,97 8,55 10,78 1,59 1,08
mtr-miR5267h MtChr2_15523828_15523911_0 new.1. TE+ AGGCATTTGCTAGAATACACCCAC 24 ATGAGTATTTTAGCAAGTGAATAACTAA 28 11,48 13,65 8,55 10,78 0 0
mtr-miR5267i MtChr2_26225142_26225207_0 new.1. TE+ AGGCATTTGCTAGAATACACCCAC 24 ATGAGTATTTTAGCAAGTGAATAA 24 11,36 13,41 8,55 10,78 0 0,12
mtr-miR5267j MtChr2_30037534_30037599_1 new.1. TE- AGGCATTTGCTAGAATACACCCAC 24 ATGAGTATTTTAGCAAGTGAATAA 24 11,24 13,53 8,55 10,78 0 0,12
mtr-miR5267k MtChr4_4728763_4728847_1 new.1. TE+ AGGCATTTGCTAGAATACACCCAC 24 ATGAGTATTTTAGCAAATGAATAACTAA 28 11,6 13,41 8,55 10,78 0 0
mtr-miR5267l MtChr4_5378554_5378619_1 new.1. TE+ AGGCATTTGCTAGGATACACCCAC 24 AGGAGTATTTTAGCAAGTGAATAA 24 5,37 5,39 2,08 2,4 1,59 1,08
mtr-miR5267m MtChr7_31380601_31380670_1 new.1. TE+/- AGGCATTTGCTAGAATACACCCAC 24 AGGAGTATTTTAGCAAGTTAATAACTAA 28 11,48 13,65 8,55 10,78 0 0
mtr-miR5267n MtChr7_31380468_31380537_1 new.1. TE+/- AGGCATTTGCTAGAATACACCCAC 24 AGGAGTATTTTAGCAAGTTAATAACTAA 28 11,48 13,65 8,55 10,78 0 0
mtr-miR5267o MtChr7_7859534_7859599_1 new.1. TE- AGGCATTTGCTAGGATACACCCAC 24 AGGAGTATTTTAGCAAGTGAATAA 24 5,37 5,51 2,08 2,4 1,59 1,08
mtr-miR5268a MtChr2_204516_204623_1 new.1. UTR-/TE- CCAGAGTGGAATGAAGATATGGTT 24 CCATGTTGATTAAGAAATTTCGGTT 25 6,72 7,31 1,95 2,4 0 0
mtr-miR5268b MtChr1_28583186_28583293_0 new.1. UTR-/TE- CCAGAGTGGAATGAAGATATGGTT 24 CCATGTTGATTAAGAAATTTCGGTT 25 6,72 7,31 1,95 2,4 0 0
mtr-miR5269a MtChr1_1514659_1514737_0 new.1. TE- AAAGTGGTGGAACATACATTGATT 24 TCATTGTGGAACTACACTTTGG 22 3,91 1,8 1,22 0,6 0 0
mtr-miR5269b MtChr4_28132026_28132111_0 new.1. I-/TE+ AAAGTGGTGGGACATACATTGATT 24 TCAATGTAGAACCTACGCTTTGA 23 14,17 15,21 5,37 4,07 0 0
mtr-miR5270a MtChr1_4647598_4647675_0 new.1. I+/TE+ GAGGAGGAGTAGTTTTAGGTCATT 24 TGGCGTTTGATTTCGCGTCTTGTCGA 26 6,47 5,39 2,08 2,87 0 0
mtr-miR5270b MtChr1_4569379_4569456_0 new.1. I+/TE+ GAGGAGGAGTAGTTTTAGGTCATT 24 TGGCGTTTGATTTCGCGTCTTGTCGA 26 6,47 5,39 2,08 2,87 0 0
mtr-miR5271a MtChr2_28961661_28961770_0 new.1. IG CGGATAATTGTGGTTACTAACGGT 24 AAATGGTTCAGTTAATTCTGAT 22 20,27 21,56 11,85 10,42 0 0
mtr-miR5271b MtChr8_33612298_33612407_0 new.1. IG CGGATAATTGTGGTTACTAACGGT 24 AAATGGTTCAGTTAATTCTGAT 22 20,27 21,56 11,85 10,42 0 0
mtr-miR5271c MtChr3_15890980_15891058_1 new.1. IG CGGATAATTGTGGTTACTAACGGT 24 TGTTATCAAAATAATTGTTCGGT 23 19,54 20,96 11,85 10,42 0 0
mtr-miR5271d MtChr4_15568523_15568600_0 new.1. IG CGGATAATTGTGGTTACTAACGGT 24 TGTTATCAAAATAATGGTTCGGT 23 19,66 20,96 11,85 10,42 0 0
mtr-miR5271e MtChr3_36560853_36560926_0 new.3. IG CGGATAATTGTGGTTACTAACGGT 24 GGTTAGTGAGTTGTTATCAAAA 22 19,66 20,96 11,85 10,42 0 0
mtr-miR5272a MtChr2_8872691_8872763_0 L.j. new.1. TE+ GAATTGATTTATGTTTGGATACAC 24 GATTCATATGAGTTGATGTTG 21 12,21 15,57 7,45 9,34 0 0
mtr-miR5272b MtChr5_35283254_35283344_1 L.j. new.1. TE- GAATTGATTTATGTTTGGATACAC 24 GGATAGTTTGAATCAAAATTGATTTTA 27 11,72 15,21 7,45 9,34 0 0
mtr-miR5272c MtChr5_41375614_41375686_1 L.j. new.1. I+/TE+ GAATTGATTTATGTTTGGATACAC 24 GATTCTTACGAATTGATGTTG 21 10,63 14,37 7,45 9,34 0 0
mtr-miR5272d MtChr5_9920025_9920098_1 L.j. new.1. TE+ GAATTGATTTATGTTTGGATACAC 24 GATTCTTACGAATTGATGTTG 21 9,53 12,81 7,45 9,34 0 0
mtr-miR5272e MtChr7_27146696_27146769_0 L.j. new.1. TE- GAATTGATTTATGTTTGGATACAC 24 GATTCTTATGAATTGATGTTGT 22 10,38 14,13 7,45 9,34 0 0
mtr-miR5272f AC159090_101796_101923_1 new.3. I+/TE+/- GAATTGATTATGTTTGGATACACT 24 TGGTTGGATAAGCCTTTTAATTGATTTTG 29 20,15 23,83 11,6 12,93 0 0
mtr-miR5273 MtChr3_29916439_29916515_0 new.3. TE+/- TAGGGGCTGTAGTTTGAGAAGAGG 24 TCAAAGATTATTAGAACACCTAAG 24 18,56 31,86 2,44 3,23 0 0
mtr-miR5274 MtChr4_11424362_11424464_0 new.1. IG CGTTCTACAATATGACGGAGTGTA 24 CACTCCGTCATATTGCGGAACGCA 24 56,55 55,09 20,15 26,35 0,24 0
mtr-miR5275 MtChr5_15176961_15177121_1 new.1. IG AGCTGGAGTCACATGCTTGAATTT 24 ATCCAAGCATGTGTCTCCAGCTTA 24 78,9 118,56 45,19 69,22 4,27 6,71
mtr-miR5276 MtChr5_22103581_22103679_1 new.1. IG AGGGGGAGCACCTTGCTGGGGCAT 24 TCCCCAACAGGCTGCTCCCCCCAA 24 22,47 25,99 21,01 24,43 0 0,12
mtr-miR5277 MtChr5_34503522_34503632_1 new.1. IG AGGTTGTTTCTTGAAGTGCAAGGC 24 CTTGGACTTCAAGAAACAACTTTG 24 4,27 5,75 2,81 3,95 0,37 0
mtr-miR5278 MtChr6_20490208_20490316_0 new.1. IG GAAATTATCTGCAGGAAATGTGAA 24 CACATTTCCTGCAGATTTTGCCAA 24 4,27 3,47 2,2 2,16 0,12 0
mtr-miR5279 MtChr8_15638376_15638469_1 new.1. TE- CGGAACCACTCGGATGACTCGGTT 24 CCGGATTAACTCGGTGACTCGGC 23 29,68 35,93 11,6 12,22 0 0
mtr-miR5280 MtChr7_16038074_16038239_0 new.1. I+/TE+/- TAATTAGAAACGGGCCGTGATGGG 24 CATCACGGGCCGTTTTTAATTACA 24 20,03 24,91 7,57 9,7 2,69 2,4
mtr-miR5281a MtChr8_19566494_19566661_0 G.m. new.1. TE- CTCTTGTAAATAGGATCGGAGGGA 24 CCTTCGGTCCTATTTACAAGAGAA 24 13,56 8,62 4,64 3,11 0,12 0
mtr-miR5281b MtChr8_20732614_20732764_1 L.j.,G.m. new.1. TE+ TCTTATAAATAGGACCGGAGGGAG 24 ACCTCCGGTCCTATTTATAAGAGA 24 80,12 54,61 28,58 14,73 0 0,12
mtr-miR5281c MtChr8_4235551_4235698_0 L.j.,G.m. new.1. I+/TE+ TCTTATAAATAGGACCGGAGGGAG 24 ACCTCCGGTCCTATTTATAAGAGA 24 92,82 69,7 28,58 14,73 0 0,12
mtr-miR5281d MtChr2_11596922_11597090_1 L.j.,G.m. new.3. TE+ TCTTATAAATAGGACCGGAGGGAG 24 ACCTCCGGTCCTATTTATAAGAGA 24 79,51 53,65 28,58 14,73 0 0,12
mtr-miR5281e MtChr6_20960063_20960190_1 L.j.,G.m. new.3. TE- TCTTATAAATAGGACCGGAGGGAG 24 CCCGCCGGTCCTATTTATAAGAGA 24 74,99 49,58 28,58 14,73 0 0
mtr-miR5281f MtChr8_27112792_27112939_0 L.j.,G.m. new.3. TE+ TCTTATAAATAGGACCGGAGGGAG 24 ACCTCCGGTTCTATTTATAAGAGA 24 90,99 68,02 28,58 14,73 0 0
mtr-miR5282 AC145023_4232_4358_0 new.3. TE+ GACGGAATTAGAGAGGGATTTCAT 24 AAAATTCCTCACAAATTCCTTGGTCGC 27 64,48 59,52 45,07 43,23 0 0
mtr-miR5283 MtChr5_40933375_40933477_0 new.3. IG CGTGCGTATCGGGATGTATCGGAA 24 TGGATACTCCCCGGATACATATCGGG 26 29,56 27,19 6,47 5,39 0 0
mtr-miR5284a MtChr1_343341_343446_0 new.3. TE- GAGGGACCAAAAGTGGAAGAATCT 24 ATTCCTCCATTTTTGGTCCTCAT 23 61,68 54,13 31,27 23,83 0 0
mtr-miR5284b MtChr4_18938375_18938485_0 new.3. TE- GAGGGATCAAAAGTGGAAGAATCT 24 ATTCCTCCACTTTTGATCCCTCAT 24 22,23 27,54 4,52 7,78 0 0
mtr-miR5284c MtChr4_30570782_30570906_1 new.3. TE- GAGGGACCAAAAGTGGAAGAATCT 24 ATTCCTCCACTTTTAGTCCCTCAT 24 71,81 62,51 31,27 23,83 0 0
mtr-miR5284d MtChr4_5567632_5567746_0 new.3. TE+ GAGGGACCAAAAGTGGAAGAATCT 24 ATTCCTCCACTTTTGGTCCCTCAT 24 62,29 55,93 31,27 23,83 0 0
mtr-miR5284e MtChr5_18136289_18136407_0 new.3. TE+ GAGGGACCAAAAGTGGAAGAATCT 24 ATTCCTCCACTTTTGGTCCCTCAT 24 74,5 68,02 31,27 23,83 0 0
mtr-miR5284f MtChr6_3514808_3514916_0 new.3. UTR+/TE- GAGGGACCAAAAGTGGAAGAATCT 24 TTTCTCCCACTTTTGGTCCCTCAT 24 68,15 59,88 31,27 23,83 0 0
mtr-miR5284g MtChr7_30966985_30967189_1 new.3. UTR+/TE- GAGGGACCAAAAGTGGAAGAATCT 24 ATTCTTTCACTTTTGGTCCCTCTT 24 74,5 68,86 31,27 23,83 0 0
mtr-miR5284h MtChr8_18120478_18120588_1 new.3. UTR-/E-/I-/TE+ GAGGGATCAAAAGTGGAGGAATCT 24 ATTCCTCCACTTTTGATCCCTCAT 24 5,5 7,07 1,1 1,44 0 0
mtr-miR5285a MtChr1_26424900_26424963_0 new.3. TE+ TGGGACTTTGGGTAGAATTAGGCG 24 ACTTATTCTTGTAACCCATTGATATCTC 28 36,64 53,17 12,09 25,03 0 0
mtr-miR5285b MtChr1_26360539_26360602_1 new.3. TE+ TGGGACTTTGGGTAGAATTAGGCG 24 ACTTATTCTTGTAACCCATTGATATCTC 28 36,64 53,17 12,09 25,03 0 0
mtr-miR5285c MtChr3_33572603_33572701_1 new.3. TE+ TGGGACTTTGGGTAGAATTAGGCG 24 ACTTATTCTTGTAACCCATTGAT 23 37,37 79,88 12,09 25,03 0 0
mtr-miR5286a MtChr2_13076794_13076861_1 new.3. TE- CAGGACAAACTGGAGGCAAGGGAC 24 CCAGTGTTTGATTTGTAAAACTGTT 25 45,68 63,23 8,92 6,23 0 0
mtr-miR5286b MtChr2_31990621_31990713_0 new.3. TE- ACAAACTGGAGGCAAGGGACAGGA 24 CATGACAGAATAACTCCAGTTGTCC 25 35,17 57,25 7,94 8,74 0 0
mtr-miR5287a MtChr2_15595353_15595516_1 L.j. new.3. TE- TGCTTATATTAGTGACCGGAGGAT 24 CTTCCGCTCACTAATATAAGCAAA 24 5,5 4,19 4,15 2,75 0 0
mtr-miR5287b MtChr6_22634167_22634329_1 L.j. new.3. TE+ TGCTTATAATAGTGATCGGAGGGT 24 CCTCCGGTCACTATTATAAGGAAA 24 8,18 5,03 3,42 1,68 0 0
mtr-miR5288 MtChr2_21069956_21070026_0 Z.m. new.3. E+ CAGCATTGAAGAACATAGGGATTA 24 GTCCCTAAATTTCTTCGCCGTGTTGAT 27 1,34 3,83 0,37 1,2 0 0
mtr-miR5289a MtChr2_29112635_29112737_1 new.3. TE+/- CGAGGAAAACTGAAAACTTCGGCA 24 CCGAATTATGGAATCGGTTGCAGTTAAC 28 66,07 77,6 20,03 24,43 0 0
mtr-miR5289b MtChr7_26966170_26966239_1 new.3. TE+ CGAGGAAAACTGAAAACTTCGGCA 24 CCGAAGTTTTCAGTTTACTGTCGAA 25 55,69 66,11 20,03 24,43 0 0
mtr-miR5290 MtChr5_2855527_2855613_0 G.m. new.3. IG AATTTGGAGAGAGATAGACACATA 24 TGGGTCAAGATCCTCTCCATTTAT 24 5,98 5,51 2,81 2,28 0 0
mtr-miR5291a MtChr2_5470025_5470092_0 Z.m.,G.m.,P.t. new.3. IG GTTTGATGGATGGATTGGATGGAT 24 CAAATCCAATCCATTAACAAATTT 24 19,17 22,28 11,6 15,09 0 0
mtr-miR5291b MtChr5_14077183_14077250_1 Z.m.,G.m.,P.t. new.3. IG GTTTGATGGATGGATTGGATGGAT 24 CAAATCCAATCCATTAACAAATAT 24 19,17 21,68 11,6 15,09 0 0
mtr-miR5291c MtChr5_9683376_9683443_1 Z.m.,G.m.,P.t. new.3. IG GTTTGATGGATGGATTGGATGGAT 24 CAAATCCAATCCATTAACAAATTA 24 19,3 21,92 11,6 15,09 0 0
mtr-miR5292a MtChr7_30182507_30182592_1 new.3. TE+ ATTCAGATGATAGCAACAAAGAGC 24 CCTTTTAGTTTTTGAATCG 19 109,8 88,86 15,39 11,62 0 0
mtr-miR5292b MtChr8_32767915_32768000_0 new.3. TE+ GATTCAGATGATAGCAACAAAGAG 24 CTTTTATTTTTTGAATCGT 19 106,62 85,75 36,52 27,31 0 0
mtr-miR5293 MtChr2_7902358_7902478_1 L.j.,A.t.,G.m. new.3. IG GATGAAGAAGTGGAAGGAAGAAGA 24 TTCTTCCCTCTATAAGAGGCATCAT 25 5,86 7,43 4,03 4,55 0 0
mtr-miR5294a MtChr2_867931_868037_1 new.3. TE+ GCTAAACGGAATGAGGGTAGTCAT 24 TCATGCCCTCAGCCGTTCAGCTA 23 19,66 22,04 10,26 13,29 0 0
mtr-miR5294b MtChr3_21775921_21776027_0 new.3. TE+ GCTAAACGGAATGAGGGTAGTCAT 24 CCATGCCCTTAGCCGTTTAACTA 23 24,55 24,79 10,26 13,29 0 0
mtr-miR5294c MtChr4_18830498_18830614_0 new.3. I-/TE+ GCTAAACGGAATGAGGGTAGTCAT 24 CCCTGCCCTCAGCCGTTTAGCTA 23 18,2 21,56 10,26 13,29 0 0
mtr-miR5295a MtChr3_37752225_37752310_1 new.3. UTR+/TE- TCGGCTCTGGGAATGAAAAGAGGC 24 AGTTTTGGATTAGTGACAGGGCCGTCC 27 19,42 21,2 12,34 10,42 0 0
mtr-miR5295b MtChr4_30525085_30525173_1 new.3. TE+/- TCGGCTCTGGGAATGAAAAGAGGC 24 TTTGTTGTCGTTTCCAGGGCCGTCC 25 24,91 26,59 12,34 10,42 0 0
mtr-miR5295c MtChr5_7533003_7533089_1 new.3. UTR+/TE- TCGGCTCTGGGAATGAAAAGAGGC 24 GGTAGTTTATGAACAGGGCCGTCC 24 21,01 22,4 12,34 10,42 0 0
mtr-miR5295d MtChr6_14324713_14324802_0 new.3. I+/TE- TCGGCTCTGGGAATGAAAAGAGGC 24 CTAACATAACACAATCATCAGGGTCGTCC 29 18,81 20,6 12,34 10,42 0 0
mtr-miR5296 MtChr3_41810750_41810859_0 new.3. TE+ ATTTTGTGTGGGTGTAAGAGGTGT 24 ACCTCTTAAAATGCAATTGACAATATTT 28 5,86 4,19 2,56 2,16 0 0
mtr-miR5297 MtChr3_43032725_43032791_0 new.3. IG ATCGGGAAGTATCGGATAATTATT 24 TAATTATCGGATACTATCCTGATGC 25 4,76 5,63 0,61 1,32 0 0
mtr-miR5298a MtChr5_5015015_5015106_1 L.j.,P.t. new.3. TE- TGGATATGATATGAAGATGAAGAA 24 CTTCATTTTCTTCTAGATTTTTC 23 7,08 5,39 2,08 0,96 0 0
mtr-miR5298b MtChr7_21153648_21153723_0 L.j.,P.t. new.3. TE- TGATGGAGATGATATGAAGATGAA 24 CATTTTCTTCTGGGATTATTTTTGTTGAA 29 68,88 65,75 23,2 20,24 0 0
mtr-miR5298c MtChr7_25885456_25885545_1 L.j.,P.t. new.3. TE- TGATGGAGATGATATGAAGATGAA 24 CATTTTCTGAAATTTTTCTCGGA 23 56,67 56,65 23,2 20,24 0 0
mtr-miR5298d MtChr8_9462377_9462455_1 new.3. TE- TGGAGATGATATGAAGATGAAAAA 24 TTTTGGGATTCTTGTTGTTGAAAGT 25 75,72 71,38 4,03 3,83 0 0
mtr-miR5299 MtChr8_15992934_15993018_1   new.3. TE+ TTCATTGGTATTGTAAAGCGACAT 24 AGAGAAGGCAATAAATAATGAATG 24 63,39 59,76 49,46 45,15 0 0
a: Plant genome conatining at least one sequence with less than three mismatches. Lj: Lotus japonicus, Zm: Zea mays, Gm: Glycine max, Pt: Populus trichocarpa,  At: Arabidopsis thaliana
b: MiRDeep stringency criteria: 1: exact definition of mature start, precursor represents canonical hairpin, stringent read distribution pattern on precursor, 2: nonstrict/canonical hairpin:; 3: strict/non-canonical hairpin; 4: nonstrict/non-canonical hairpin 
c: IG: intergenic region; E: exon; I: intron; TE: transposable element, npc: non-protein coding gene, +: sense; -: antisense strand